TotalSeq™-A0405 anti-human CD284 (TLR4) Antibody

Pricing & Availability
Clone
HTA125 (See other available formats)
Workshop
HCDM listed
Other Names
Toll-like Receptor 4, TLR4, TLR-4, CD284
Isotype
Mouse IgG2a, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
312817 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Toll-like receptors are type I transmembrane signaling receptors. They are primordial pathogen-recognition proteins that function as sentinels for the innate immune system. TLR4, also known as CD284, is a 110 kD protein which is expressed on monocytes/macrophages, endothelial cells, and at low levels on B cells and granulocytes. In association with a secretory molecule, MD2, TLR4 has been recognized as critical for host recognition of bacterial LPS. HTA125 antibody is useful for flow cytometric analysis and is able to block LPS-induced cytokine production.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Human, Cross-Reactivity: Guinea Pig
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Ba/F3 cell line expressing human TLR4
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections4, immunofluorescence microscopy6, Western blotting10, and in vitro blocking of LPS-induced cytokine production2,3,7,9. This clone was tested in-house and does not work on formalin fixed paraffin-embedded (FFPE) tissue. For most successful immunofluorescent staining results, it may be important to maximize signal over background by using a relatively bright fluorochrome-antibody conjugate (Cat. No. 312806) or by using a high sensitivity, three-layer staining technique (e.g., including a biotinylated antibody (Cat. No. 312804) or biotinylated anti-mouse IgG second step (Cat. No. 405303), followed by SAv-PE (Cat. No. 405204). The LEAF™ purified antibody (Endotoxin <0.1 EU/μg, Azide-Free, 0.2 μm filtered) is recommended for functional assays (Cat. No. 312807). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 312814) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin <0.01 EU/µg).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The TotalSeq™-A barcode sequence associated with clone HTA125 is GCTTAGCTGTATCCG.

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the capture sequence, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [GCTTAGCTGTATCCG]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Skimazu R, et al. 1999. J. Exp. Med. 189:1777.
  2. Wang R, et al. 2003. Hybrid Hybridomics 22:357. (Block)
  3. Wang JE, et al. 2001. Infect. Immun. 69:2402. (Block)
  4. Ishihara S, et al. 2004 J. Immunol. 173:1406. (IHC)
  5. Kawahara T, et al. 2001 Infect. Immun. 69:4382.
  6. Jiang Q, et al. 2000. J. Immunol. 165:3541. (IF)
  7. Sugawara S, et al. 2001. Infect. Immun. 69:4951. (Block)
  8. Chavakis E, et al. 2007. Circ. Res. 100:204. PubMed
  9. Bhattacharyya S, et al. 2007. Am. J. Physiol. Gastrointest Liver Physiol. doi:10.1152/ajpgi.00149. (Block) PubMed
  10. Baumgarten G, et al. 2001. J. Infectious. Dis. 183:1617.
RRID
AB_2783183 (BioLegend Cat. No. 312817)

Antigen Details

Structure
Type I transmembrane protein, Toll-like receptor family/IL-1R superfamily, 110 kD
Distribution

Monocytes/macrophages, endothelial cells, B cells and granulocytes

Function
Activates the innate immune system against Gram-negative bacterial pathogens by recognition of LPS
Ligand Receptor
Bacterial LPS
Cell Type
B cells, Endothelial cells, Granulocytes, Macrophages, Monocytes, Tregs
Biology Area
Cell Biology, Immunology, Innate Immunity, Neuroinflammation, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules, Toll Like Receptors
Antigen References

1. Skimazu R, et al. 1999. J. Exp. Med. 189:1777.

Gene ID
7099 View all products for this Gene ID
UniProt
View information about CD284 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 10/15/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account