TotalSeq™-A0400 anti-human CD144 (VE-Cadherin) Antibody

Pricing & Availability
Clone
BV9 (See other available formats)
Other Names
VE-Cadherin, cadherin-5, CDH5
Isotype
Mouse IgG2a, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
348517 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD144, also known as VE-cadherin and cadherin-5, is a 140 kD glycoprotein which is composed of five extracellular cadherin repeats and a highly conserved cytoplasmic tail region. It is a calcium-dependent transmembrane cell-cell adhesion molecule localized at the intercellular boundaries of endothelial cells, hematopoietic stem cells, and perineurial cells. It functions as a classic cadherin by mediating homophilic adhesion and functions as a plasma membrane attachment site for the cytoskeleton. CD144 is thought to play a role in vascular development, permeability, and remodeling.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone BV9 has been shown to block VE-cadherin, causing a redistribution of VE-cadherin away from intracellular junctions.6 This clone binds to EC3-EC4 region in the extracellular domain of human VE-cadherin.7 Additional reported applications (for the relevant formats) include: Western Blotting1,2, immunofluorescence microscopy1,3, immunoprecipitation1,4, blocking angiogenesis in vitro4,5, inhibiting VE-cadherin reorganization4, and inducing endothelial cell apoptosis4. The LEAF™ purified antibody (Endotoxin <0.1 EU/μg, Azide-Free, 0.2 μm filtered) is recommended for functional assays (contact our custom solutions team).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The TotalSeq™-A barcode sequence associated with clone BV9 is TCCACTCATTCTGTA.

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the capture sequence, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [TCCACTCATTCTGTA]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Almagro S, et al. 2010. Mol. Cell Biol. 30:1703. (WB, IF, IP)
  2. Zhang F, et al. 2004. J. Biol. Chem. 279:11760. (WB)
  3. Iurlaro M, et al. 2004. Am. J. Pathol. 165:181. (IF)
  4. Corada M, et al. 2001. Blood 97:1679. (IP, Block)
  5. Kooistra M, et al. 2005. FEBS 579:4966. (Block)
  6. Corada M, et al. 2001. Blood 97:1679. (Block)
  7. Bouillet L, et al. 2013. Laboratory Investigation 93:1194-11202.
RRID
AB_2783239 (BioLegend Cat. No. 348517)

Antigen Details

Structure
Member of the cadherin family; calcium-dependent transmembrane cell-cell adhesion glycoprotein composed of five extracellular cadherin repeats and a highly conserved cytoplasmic tail region
Distribution

Endothelial cells, hematopoietic stem cells, perineurial cells

Function
Mediates calcium-dependent homophilic cell adhesion, plays fundamental roles in microvascular permeability and in the morphogenic and proliferative events associated with angiogenesis
Ligand Receptor
VE-cadherin
Cell Type
Endothelial cells, Hematopoietic stem and progenitors, Mesenchymal Stem Cells
Biology Area
Angiogenesis, Cell Adhesion, Cell Biology, Cell Motility/Cytoskeleton/Structure, Immunology, Stem Cells
Molecular Family
Adhesion Molecules, CD Molecules, Protein Kinases/Phosphatase
Antigen References

1. Taddei A, et al. 2008. Nat. Cell Biol. 10:923.
2. Gavard J, et al. 2006. Nat. Cell Biol. 8:1223.
3. Kim I, et al. 2005. Blood 106:903.
4. Suzuki S, et al. 1991. Cell Regul. 2:261.

Gene ID
1003 View all products for this Gene ID
UniProt
View information about CD144 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 11/15/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account