TotalSeq™-A0386 anti-human CD28 Antibody

Pricing & Availability
Clone
CD28.2 (See other available formats)
Workshop
V-CD28.05
Other Names
T44, Tp44
Isotype
Mouse IgG1, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
302955 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD28 is a 44 kD disulfide-linked homodimeric type I glycoprotein. It is a member of the immunoglobulin superfamily and is also known as T44 or Tp44. CD28 is expressed on most T lineage cells, NK cell subsets, and plasma cells. CD28 binds both CD80 and CD86 using a highly conserved motif MYPPY in the CDR3-like loop. CD28 is considered a major co-stimulatory molecule, inducing T lymphocyte activation and IL-2 synthesis, and preventing cell death. In vitro studies indicate that ligation of CD28 on T cells by CD80 and CD86 on antigen presenting cells provides a costimulatory signal required for T cell activation and proliferation.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Human, Baboon, Capuchin Monkey, Chimpanzee, Cynomolgus, Pigtailed Macaque, Rhesus, Sooty Mangabey, Squirrel Monkey
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunoprecipitation, immunohistochemical staining of acetone-fixed frozen tissue sections4, and in vitro T cell costimulation5-8. This clone was tested in-house and does not work on formalin fixed paraffin-embedded (FFPE) tissue. The CD28.2 antibody co-stimulates T cell proliferation and cytokine production in the presence of suboptimal amounts of anti-CD3 antibody. The LEAF™ purified antibody (Endotoxin <0.1 EU/μg, Azide-Free, 0.2 μm filtered) is recommended for functional assays (Cat. No. 302914). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 302934) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin <0.01 EU/µg).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The TotalSeq™-A barcode sequence associated with clone CD28.2 is TGAGAACGACCCTAA.

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the capture sequence, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [TGAGAACGACCCTAA]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
  2. Nunes J, et al. 1993. Biochem. J. 293:835.
  3. Calea-Lauri J, et al. 1999. J. Immunol. 163:62.
  4. Tazi A, et al. 1999. J. Immunol. 163:3511. (IHC)
  5. Marti F, et al. 2001. J. Immunol. 166:197. (Costim)
  6. Jeong SH, et al. 2004. J. Virol. 78:6995. (Costim)
  7. Rivollier A, et al. 2004. Blood 104:4029. (Costim)
  8. Scharschmidt E, et al. 2004. Mol. Cell Biol. 24:3860. (Costim)
  9. Sheng W, et al. 2007.Elsevier 580:6819. PubMed
  10. Mitsuhashi M. 2007. Clin Chem.53:148. PubMed
  11. Ye Z, et al. 2008. Infect. Immun. 76:2541. PubMed
  12. Magatti M, et al. 2008. Stem Cells 26:182. (FA) PubMed
  13. Yoshino N, et al. 2008. Exp. Anim. (Tokyo) 49:97. (FC)
  14. Berg M, et al. 2008. J Leukoc Biol. 83:853. (IP) PubMed
  15. Rout N, et al. 2010. PLoS One 5:e9787. (FC)
  16. Leonard JA, et al. 2011. J. Virol. 85:6867. PubMed
  17. Nomura T, et al. 2012. J. Virol. 86:6481. PubMed
RRID
AB_2783159 (BioLegend Cat. No. 302955)

Antigen Details

Structure
Ig superfamily, type I transmembrane glycoprotein, homodimer, 44 kD
Distribution

Mature T cells, thymocytes, NK cell subsets, plasma cells, EBV-positive B cells

Function
T cell costimulation
Ligand Receptor
CD80, CD86
Cell Type
B cells, NK cells, Plasma cells, T cells, Thymocytes, Tregs
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
2. June CH, et al. 1994. Immunol. Today 15:321.
3. Linskey PS, et al. 1993. Annu. Rev. Immunol. 11:191.

Gene ID
940 View all products for this Gene ID
UniProt
View information about CD28 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 11/15/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account