TotalSeq™-A0380 anti-rat CD90/mouse CD90.1 (Thy-1.1) Antibody

Pricing & Availability
Clone
OX-7 (See other available formats)
Other Names
Thy-1, Thy-1.1
Isotype
Mouse IgG1, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
202547 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD90, also known as Thy-1, is a 28-30 kD GPI-linked membrane glycoprotein. It is a member of the immunoglobulin superfamily and has been shown to interact with CD45 in signal transduction during lymphocyte proliferation and differentiation. CD90 is expressed on hematopoietic stem cells, neurons, thymocytes, peripheral T cells, fibroblasts, stromal cells.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Rat, Mouse (AKR/J, PL, and FVBIN mouse strains), Cross-Reactivity: Rabbit (Lapine), Guinea Pig
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Rat thymocyte Thy-1 antigen
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The OX-7 antibody reacts with rat CD90 and mouse CD90.1 (Thy-1.1) (which is expressed by mouse strains of AKR/J, PL, and FVB/N), but not mouse CD90.2.

Additional reported applications (for the relevant formats) include: immunohistochemical7 and immunofluorescent8 staining of acetone-fixed frozen sections and zinc-fixed paraffin-embedded sections, immunoprecipitation1, Western blotting1, in vitro activation of leukocytes2, induction of endothelial cell permeability3, induction of apoptosis in glomerular mesangial cells, and induction of glomerulonephritis in vivo4.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The TotalSeq™-A barcode sequence associated with clone OX-7 is AGTATGGGATGCAAT.

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the capture sequence, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA
[AGTATGGGATGCAAT]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Jeng CJ, et al. 1998. J. Cell Biol. 140:685. (IP, WB)
  2. Nakashima I, et al. 1991. J. Immunol. 147:1153.
  3. Ishizu A, et al. 1995. Int. Immunol. 7:1939.
  4. Eitner F. 1997. Kidney. Int. 51:69.
  5. Kawachi H, et al. 1992. Clin. Exp. Immunol. 88:399. (WB)
  6. Dyer KD, et al. 2007. J. Immunol. 179:1693. (FC) PubMed
  7. Daniel C, et al. 2012. Lab Invest. 92:812. (IHC-P)
  8. Li B, et al. 2006. Kidney Int. 69:323. (ICC)
  9. Uchimura H, et al. 2005. J Am Soc Nephrol. 16(4):997-1004. (IHC-F)
  10. Inagi R, et al. 2008. J Am Soc Nephrol. 19(5):915-22. (IHC-P)
RRID
AB_2783141 (BioLegend Cat. No. 202547)

Antigen Details

Structure
Ig superfamily, GPI-anchored membrane glycoprotein, 28-30 kD
Distribution

Hematopoietic stem cells, thymocytes, a subset of peripheral blood T cells, early myeloid and erythroid progenitors, immature B cells, neurons, activated endothelium, mast cells, dendritic cells, glomeruli

Function
Adhesion, signal transduction, lymphocyte co-stimulation, proliferation and differentiation of hematopoietic stem cells
Ligand Receptor
Interacts with CD45
Cell Type
B cells, Dendritic cells, Endothelial cells, Hematopoietic stem and progenitors, Mast cells, Neurons, T cells, Thymocytes
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Campbell DG, et al. 1981. Biochem. J. 195:15.
2. Hosseinzadeh H, et al. 1993. J. Immunol. 150:1670.

Gene ID
21838 View all products for this Gene ID 24832 View all products for this Gene ID
UniProt
View information about CD90.1 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 12/17/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account