TotalSeq™-A0376 anti-mouse CD195 (CCR5) Antibody

Pricing & Availability
Clone
HM-CCR5 (See other available formats)
Other Names
CCR5, C-C chemokine receptor type 5, HIV-1 fusion co-receptor
Isotype
Armenian Hamster IgG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
107019 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD195 is a 45 kD chemokine receptor also known as CCR5. CD195 is a seven transmembrane-spanning G protein-associated molecule expressed on macrophages, a T cell subset, and in the heart, liver, and spleen. CD195 regulates lymphocyte chemotaxis and transendothelial migration during inflammatory processes. CD195 interacts with several ligands including RANTES, MCP-1, MIP-1α, and MIP-1β.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Armenian Hamster
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

CCR5 is expressed at low density on activated cells. For successful immunofluorescent staining results, it may be important to maximize signal over background by using a relatively bright fluorochrome-antibody conjugate (Cat. No. 107006) or by using a high sensitivity, three-layer staining technique (e.g., including a biotinylated antibody (Cat. No. 107004) or biotinylated anti-Armenian hamster IgG (Cat. No. 405501) second step, followed by SAv-PE (Cat. No. 405204)).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

 

The TotalSeq™-A barcode sequence associated with clone HM-CCR5 is ACCAGTTGTCATTAC.

 

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the poly A tail, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, where B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

 

The full oligomer sequence for this product, with the specific barcode in brackets is  CCTTGGCACCCGAGAATTCCA[ACCAGTTGTCATTAC]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Mao A, et al. 2005. J. Immunol. 175:5146. (FC) PubMed
  2. Ishida Y, et al. 2007. Am J Pathol.170:843.(FC) PubMed
  3. Zeiser Z, et al. 2008. Blood 111:453. (FC) PubMed
  4. Sharma R, et al. 2009. J. Immunol.. 183:3212 (FC) PubMed
  5. Kohlmeier JE, et al. 2008. Immunity. 29:101. (FC) PubMed
RRID
AB_2783049 (BioLegend Cat. No. 107019)

Antigen Details

Structure
β-chemokine receptor, 45 kD
Distribution

Macrophages, T cell subset, heart, spleen, liver

Function
Lymphocyte chemotaxis and transendothelial migration during inflammation, signaling through seven transmembrane-spanning G proteins
Ligand Receptor
RANTES, MCP-1, MIP-1α, and MIP-1β
Cell Type
Macrophages, T cells, Dendritic cells
Biology Area
Immunology, Innate Immunity
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Barclay AN, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Napolitano M, et al. 1990. J. Exp. Med. 172:285.
3. Meyer A, et al. 1996. J. Biol. Chem. 271:14445.
4. Boring, et al. 1996. J. Biol. Chem. 271:7551.

Gene ID
12774 View all products for this Gene ID
UniProt
View information about CD195 on UniProt.org

Related FAQs

Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?

Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.

Go To Top Version: 1    Revision Date: 11/28/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account