TotalSeq™-A0351 anti-human CD135 (Flt-3/Flk-2) Antibody

Pricing & Availability
Clone
BV10A4H2 (See other available formats)
Other Names
FMS-like tyrosine kinase-3, FLT-3, STK-1, Flk-2
Isotype
Mouse IgG1, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
313317 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD135 is a 130-160 kD type III tyrosine kinase receptor expressed on CD34+ hematopoietic stem cells, myelomonocytic progenitors, primitive B cell progenitors, and thymocytes. CD135 is also expressed on malignant hematopoietic cells including AML, ALL and CML-BC. CD135, also known as FMS-like tyrosine kinase-3, FLT3, STK-1, and Flk-2, is a growth factor receptor that binds the FLT3 ligand to promote the growth and differentiation of primitive hematopoietic cells. The intracytoplasmic domain of CD135 is modified by phosphorylation and has been shown to interact with Grb2, SOCS1, VAV1, and Shc.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
BV-173 pro-B cell line
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The TotalSeq™-A barcode sequence associated with clone BV10A4H2 is CAGTAGATGGAGCAT .

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the capture sequence, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [CAGTAGATGGAGCAT]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

RRID
AB_2783188 (BioLegend Cat. No. 313317)

Antigen Details

Structure
Member of the immunoglobulin supergene family, type 3 tyrosine kinase receptor; 130-160 kD
Distribution

Expressed on CD34+ hematopoietic stem cells, myelomonocytic progenitors, primitive B cell progenitors, and thymocytes. Also expressed on AML, ALL and CML-BC tumor cells

Function
Tyrosine kinase growth factor receptor involved in the growth and differentiation of primitive hematopoietic cells
Ligand Receptor
FLT3 ligand
Cell Type
B cells, Hematopoietic stem and progenitors, Thymocytes
Biology Area
Cell Biology, Immunology
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Rappold I, et al. 1997. Blood 90:111.
2. Rosnet O, et al. 1996. Acta Haematol. 95:218.
3. Rosnet O, et al. 1996. Leukemia 10:238.
4. Bertho JM, et al. 2000. Scand. J. Immunol. 52:53.

Gene ID
2322 View all products for this Gene ID
UniProt
View information about CD135 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 10/29/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account