TotalSeq™-A0315 anti-mouse Hashtag 15 Antibody

Pricing & Availability
Clone
M1/42; 30-F11 (See other available formats)
Other Names
Mouse major histocompatibility complex H-2, MHC, T200, Ly-5, LCA
Isotype
Rat IgG2a, κ/Rat IgG2b, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
155829 10 µg £306
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

TotalSeq™ anti-mouse Hashtag reagent is a mixture of two monoclonal antibodies conjugated to the same oligonucleotide. The antibodies are specific against mouse CD45 and MHC class I (of a, b,  d, j, k, s, and u haplotypes) and can be used to label hematopoietic and non-hematopoietic cells in most commonly used mouse strains for multiplex single cell sequencing analysis. The conjugated antibodies are pre-mixed to be used following an optimized protocol similar to the CITE-seq workflow.

CD45 is a 180-240 kD glycoprotein also known as the leukocyte common antigen (LCA), T200, or Ly-5. It is a member of the protein tyrosine phosphatase (PTP) family, expressed on all hematopoietic cells except mature erythrocytes and platelets. CD45 plays a key role in TCR and BCR signal transduction.

MHC class I is involved in antigen presentation to T cells expressing CD3/TCR and CD8 proteins. The M1/42 antibody reacts with the H-2 MHC class I alloantigens expressed on nucleated cells from mice of the a, b, d, j, k, s, and u haplotypes (Stallcup, KC et al, 1981).

Importantly, some cell lines or experimental models may lack or express very low levels of either or both CD45 and MHC I molecules. We recommend a pilot experiment before single cell proteogenomics to confirm expression of these molecules in your experimental system. Different mouse strains express different MHC I haplotypes. Please refer to the supplemental table for detailed information about the haplotype of your experimental model. The supplemental table and summary below are not exhaustive and provide just a summary of common laboratory mouse strains recognized by TotalSeq™ anti-mouse Hashtags.

Mouse strains recognized by clone M1/42: 129/-; A/J; AKR/J; BALB/cAnN; BALB/cBy; BALB/CJ; BXSB/Mp; C3H/Bi; C3H/He; C3HeB/FeJ; C57BL/6; C57BL/10; C57BLR/cdj; C57L/J; C58/J; C.B-17; CBA/Ca; CBA/J; CBA/N; CE/J; DA/HuSn; GRS/J; HRS/J; I/LnJ; LP/J; MA/MyJ; MRL/Mp; NOD; NZB/-; PL/J; RF/J; SEC/-; SJL/J; ST/bJ; SWR/J.

Strains that are not recognized by clone M1/42: BDP/J; BUB/BnJ; DBA/1; FVB/N; NZW/-; P/J; SM/J.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this reagent is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is 0.1 to 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

 

To maximize performance, centrifuge the antibody dilution (0.1 - 1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. It is also recommended that users test the reactivity of the reagents to their target cells of interest before actual studies.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ Hashtag reagents can be used for multiplexing different samples; optimization of microfluidics instruments to load a high number of cells, and discriminate droplets containing  more than one cell; performing TotalSeq™ antibody titrations, etc.  A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode sequence associated with anti-mouse Hashtag 15 is CCCTCTCTGGATTCT.

The flanking sequences are GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT, and the poly A tail, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, where B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT [CCCTCTCTGGATTCT]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

RRID
AB_2783129 (BioLegend Cat. No. 155829)

Antigen Details

Cell Type
Mesenchymal Stem Cells
Biology Area
Stem Cells
Gene ID
111364 View all products for this Gene ID 19264 View all products for this Gene ID

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 07/02/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account