TotalSeq™-A0248 anti-human CD62E Antibody

Pricing & Availability
Clone
HAE-1f (See other available formats)
Other Names
E-selectin, ELAM-1, LECAM-1
Isotype
Mouse IgG1, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
336017 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD62E (also known as E-selectin, ELAM-1, and LECAM-1) is a 115 kD type I membrane protein and a member of the selectin family. CD62E is highly expressed on activated endothelial cells (IL-2, TNF-α, other cytokines can increase expression) and can also be expressed on endothelial cells in the skin, bone marrow and placenta. CD62E is involved in tethering and leucocyte rolling on activated endothelium at inflammatory sites and may also play a role in tumor metastasis and angiogenesis. CD62E binds to both Siayl Lewis X (CD15s) and PSGL-1 (CD162).The HAE-1f antibody has been shown to recognize human CD62E and to be useful for flow cytometry and in vitro blocking.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications: blocks CD62E binding to its ligand

Additional Product Notes

TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The TotalSeq™-A barcode sequence associated with clone HAE-1f is CTCCCTGTGGCTTAA.

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the capture sequence, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [CTCCCTGTGGCTTAA]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Tu L, et al. 1996. J. Immunol. 157:3995
  2. Zhang Y and S. Neelamegham. 2002. Biophys. J. 83:1934
RRID
AB_2783218 (BioLegend Cat. No. 336017)

Antigen Details

Structure
Member of the selectin family, 115 kD type I membrane protein; contains one C-type lectin domain and one EGF-like domain
Distribution

Highly expressed on activated endothelial cells (IL-2, TNF-α), other cytokines can increase expression); can also be expressed on endothelial cells in the skin, bone marrow and placenta.

Function
Involved in tethering and leucocyte rolling on activated endothelium at inflammatory sites, may also play a role in tumor metastasis and angiogenesis
Ligand Receptor
Siayl Lewis X (CD15s) and PSGL-1 (CD162) bind to CD62E. Recently, CLA (cutaneous lymphocyte antigen) has also been reported in interact with CD62E
Cell Type
Endothelial cells
Biology Area
Angiogenesis, Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Collins T, et al. 1991. J. Biol. Chem. 266:2466
2. Bevilacqua MP, et al. 1987. Proc. Natl. Acad. Sci. USA 84:9238
3. Berg EL, et al. 1991. J. Exp. Med. 174:1461.
4. Lawrence MB, et al. 1993. J. Immunol. 151:6338.
5. Walz G, et al. 1990. Science 250:1132

Gene ID
6401 View all products for this Gene ID
UniProt
View information about CD62E on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 11/27/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account