TotalSeq™-A0232 anti-mouse MAdCAM-1 Antibody

Pricing & Availability
MECA-367 (See other available formats)
Other Names
Mucosal addressin cell adhesion molecule-1
Rat IgG2a, κ
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Avail. Save
120713 10 µg £218
Check Availability

Need larger quantities of this item?
Request Bulk Quote

MAdCAM-1 is a 58-66kD type I glycoprotein, also known as Mucosal addressin cell adhesion molecule-1. This mucosal vascular addressin is a member of the Ig superfamily found on fetus and neonatal endothelial cells. In adults, MAdCAM-1 is predominately expressed on high endothelial venule (HEV) of Peyer's patches, mesenteric lymph nodes and gut lamina propria. It is also expressed on vascular endothelium in mammary glands and pancreas. MAdCAM-1, through its interaction with integrin α4β7 or CD62L, is involved in lymphocyte tethering, rolling, and homing. It has been reported that immobilized MAdCAM-1 is able to co-stimulate T cell proliferation. The MECA-367 antibody blocks the interaction of MAdCAM-1 with its counter-receptor both in vitro and in vivo. In vivo administration of the mAb is able to reduce T-cell mediated inflammation in some gastrointestinal diseases.

Product Details
Technical Data Sheet (pdf)

Product Details

Antibody Type
Host Species
Endothelial cells
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: in vitro and in vivo blocking of lymphocyte adhesion and in vivo blocking of lymphocyte homing1-4,7, immunohistochemical staining1,5,6 of acetone-fixed frozen sections, immunoprecipitation, and Western blotting1.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The TotalSeq™-A barcode sequence associated with clone MECA-367 is TTGGGCGATTAAGAA.

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the capture sequence, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [TTGGGCGATTAAGAA]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Streeter PR, et al. 1988. Nature 331:41.
  2. Briskin MJ, et al. 1993. Nature 363:461.
  3. Berlin C, et al. 1993. Cell 74:185.
  4. Bargatze RF, et al. 1995. Immunity 3:99.
  5. Tanneau GM, et al. 1999. J. Histochem. Cytochem. 47:1581.
  6. Savinov AY, et al. 2003. J. Exp. Med. 197:643.
  7. Rivera-Nieves J, et al. 2005. J. Immunol. 174:2343.
  8. Hindley JP, et al. 2012. Cancer Res. 72:5473. PubMed.
AB_2783058 (BioLegend Cat. No. 120713)

Antigen Details

Type I glycoprotein, Ig superfamily

HEV of mucosal lymphoid organ and lamina propia, endothelial cells in mammary glands and pancreas

Lymphocyte tethering, rolling and homing, costimulate T cell proliferatioon
Ligand Receptor
Integrin a4ß7, CD62L
Cell Type
Endothelial cells
Biology Area
Cell Adhesion, Cell Biology, Immunology
Molecular Family
Adhesion Molecules
Antigen References

1. Streeter PR, et al. 1988. Nature 331:41
2. Briskin MJ, et al. 1993.Nature 363:461.
3. Berlin C, et al. 1993. Cell 74:185.
4. Lehnert K, et al. 1998. Eur. J. Immunol. 28:3605.
5. Picarella D, et al. 1997. J. Immunol. 158:2099.

Gene ID
17123 View all products for this Gene ID
View information about MAdCAM-1 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 11/28/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account