TotalSeq™-A0211 anti-mouse TCR Vγ2 Antibody

Pricing & Availability
Clone
UC3-10A6 (See other available formats)
Other Names
Vγ2 T-cell receptor, T cell receptor gamma 2
Isotype
Armenian hamster IgG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
137709 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

T cell receptor (TCR) Vγ2 bearing T lymphocytes make up a significant proportion of γδ TCR cells in late fetal and adult peripheral lymphoid tissues. TCR γδ T cells may play a role in immunological surveillance for stress-induced self-antigens. The frequency of Vγ2 expression in different strains varied from 12% to 54% in the TCR γδ repertoire. Variations in the levels of Vγ2+ cells are not associated with MHC haplotype. High Vγ2 expression is influenced by the TCR-δ locus.  Expanding Vγ2+ TCRγδ cells in B6 mice overwhelmingly use a Vδ7+ δ chain except in the DBA/2 strain.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Armenian Hamster
Immunogen
G8 mouse T cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The TotalSeq™-A barcode sequence associated with clone UC3-10A6 is AAGCTGCACCGTAAT.

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the capture sequence, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [AAGCTGCACCGTAAT]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Dent AL, et al. 1990. Nature 343:714.
  2. Kelly KA, et al. 1993. Int. Immunol. 5:331.
  3. Sperling AI, et al. 1992. J. Immunol. 149:3200.
  4. Sperling AI, et al. 1997. J. Immunol. 159:86.
RRID
AB_2783100 (BioLegend Cat. No. 137709)

Antigen Details

Structure
A member of Ig superfamily, associated with TCR δ chain and CD3 complex.
Distribution

T cell subset in fetal and adult peripheral lymphoid tissues and thymus.

Function
Might play a role in a previously unrecognized form of immunological surveillance for stress-induced self-antigens.
Ligand Receptor
Antigens
Cell Type
T cells
Biology Area
Immunology, Adaptive Immunity
Molecular Family
TCRs
Antigen References

1. Allison JP, et al. 1991. Annu. Rev. Immunol. 9:679.
2. O’Brien RL, et al. 2000. J. Immunol. 165:6472.

Gene ID
110067 View all products for this Gene ID
UniProt
View information about TCR V gamma2 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 11/27/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account