TotalSeq™-A0203 anti-mouse CD150 (SLAM) Antibody

Pricing & Availability
Clone
TC15-12F12.2 (See other available formats)
Other Names
Signaling Lymphocyte Activation Molecule (SLAM), IPO-3
Isotype
Rat IgG2a, λ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
115945 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD150 is a 75-95 kD member of the immunoglobulin superfamily, also known as SLAM (signaling lymphocyte activation molecule) or IPO-3. CD150, a single chain type I transmembrane molecule, is expressed on thymocytes, T cell subsets, B cells, dendritic cells, and endothelial cells. The expression is upregulated upon activation. CD150 expression has been shown to be maintained on Th1 but not Th2 clones. T regulatory cells express a relatively high level of CD150. Antibodies against CD150 have been shown to augment IFN-γ production by Th1 cells, especially when co-stimulated through the TCR. CD150 associates with the src homology 2-domain-containing protein tyrosine phosphatase SHP-2, and this association is thought to be involved in signal transduction. In combination with CD48, CD150 is a useful marker for hematopoietic stem cell studies.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Mouse SLAM-human IgG1 fusion protein
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The TC15-12F12.2 antibody has been reported to enhance the production of IFN-γ by Th1 cells stimulated through TCR. Additional reported applications (for the relevant formats) include: immunoprecipitaion17, enhancing IFN-γ production by Th1 cells when stimulated with CD31, and inhibiting CD3 induced T cell proliferation6. The LEAF™ purified antibody (Endotoxin <0.1 EU/μg, Azide-Free, 0.2 μm filtered) is recommended for functional assays (Cat. No. 115906).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

 

The TotalSeq™-A barcode sequence associated with clone TC15-12F12.2 is CAACGCCTAGAAACC.

 

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the poly A tail, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, where B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

 

The full oligomer sequence for this product, with the specific barcode in brackets is  CCTTGGCACCCGAGAATTCCA [CAACGCCTAGAAACC]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Castro AG, et al. 1999. J. Immunol. 163:5860. (FC, Costim, IP)
  2. Forsberg EC, et al. 2005. PLoS Genet. 1:e28. (FC)
  3. Terrazas LI, et al. 2005. Int. J. Parasitol. 35:1349. (FC)
  4. Cannons JL, et al. 2006. J. Exp. Med. 203:1551. (FC)
  5. Umemoto T, et al. 2006. J. Immunol. 177:7733. (FC)
  6. Jordan MA, et al. 2007. J. Immunol. 178:1618. (FC, Block) PubMed
  7. Jung Y, et al. 2007. Blood 110:82. PubMed
  8. Pimanda JE, et al. 2007. Proc. Natl. Acad. Sci. USA 104:840.
  9. Sugiyama T, et al. 2007. Proc. Natl. Acad. Sci. USA 104:175.
  10. Kim I, et al. 2006. Blood 108:737. PubMed
  11. Ema H, et al. 2006. Nat Protoc. 1:2979. PubMed
  12. Fraser ST, et al. 2007. Blood 109:4616. PubMed
  13. Jung Y, et al. 2008. Stem Cells. 26:2042. Pubmed
  14. Song J, et al. 2010. Blood 115:2592. PubMed
  15. Cridland SO, et al. 2009. Blood Cell. Mol. Dis. 43:149. (FC) PubMed
  16. Morita Y, et al. 2010. J. Exp Med. 207:1173. PubMed
  17. Talaei N, et al. 2015. J. Immunol. 195(10):4623. PubMed
RRID
AB_2783055 (BioLegend Cat. No. 115945)

Antigen Details

Structure
Ig superfamily, 75-95 kD
Distribution

Thymocytes, T cell subset, B lymphocytes, dendritic cells, endothelial cells

Function
B cell and dendritic cell costimulation
Ligand Receptor
CD150
Cell Type
B cells, Dendritic cells, Endothelial cells, T cells, Thymocytes, Tregs
Biology Area
Immunology, Innate Immunity
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Cocks BG, et al. 1995. Nature 376:260.
2. Punnonen J, et al. 1997. J. Exp. Med. 185:993.
3. Sidorenko SP, et al. 1993. J. Immunol. 151:4614.

Gene ID
27218 View all products for this Gene ID
UniProt
View information about CD150 on UniProt.org

Related FAQs

Can I an isotype control with a lambda light chain be substituted with an isotype control with a kappa light chain for flow cytometry?

Yes, you can since kappa and lambda represent light chains which don't contribute to the background staining.

Go To Top Version: 1    Revision Date: 08/30/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account