TotalSeq™-A0158 anti-human CD134 (OX40) Antibody

Pricing & Availability
Clone
Ber-ACT35 (ACT35) (See other available formats)
Other Names
ACT35 antigen, tumor necrosis factor receptor superfamily member 4 (TNFRSF4)
Isotype
Mouse IgG1, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
350033 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD134, also known as OX40 and TNFRSF4, is a 50 kD type I transmembrane glycoprotein. It is a member of the TNF receptor family. OX40 is expressed on activated T lymphocytes including Th1, Th2, Th17, and Treg cells. The interaction of OX40 with OX40L results in B cell proliferation and antibody secretion, regulation of primary T cell expansion, and T cell survival. OX40 influences the size of the T cell memory pool and regulation of CD4+ T cell tolerance.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Human, Cross-Reactivity: Chimpanzee
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
HTLV 1-transformed HUT 102 cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: Western blotting1, immunoprecipitation1, immunohistochemical staining2,3of paraffin embedded7 and frozen tissue sections, ELISA4, and functional assay5. The LEAF™ or Ultra-LEAF™ purified antibody is recommended for functional assays (contact our custom solutions team).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical supportfor more information, or visit biolegend.com/totalseq.

 

The TotalSeq™-A barcode sequence associated with clone Ber-ACT35 (ACT35) is AACCCACCGTTGTTA.

 

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the poly A tail, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, where B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

 

The full oligomer sequence for this product, with the specific barcode in brackets is  CCTTGGCACCCGAGAATTCCA [AACCCACCGTTGTTA]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Latza U, et al. 1994. Eur. J. Immunol. 24:677. (WB, IP)
  2. Durkop H, et al. 1995. Brit. J. Haematol. 91:927. (IHC)
  3. Durkop H, et al. 1997. Brit. J. Haematol. 98:863. (IHC)
  4. Willett B, et al. 2007. J. Virol. 81:9665. (ELISA)
  5. Li M and Zhang Y. et al. 2005. Cell. Mol. Immunol. 2:467. (FA)
  6. Gloviczki ML, et al. 2012. Clin. J. Am. Soc. Nephrol. 8:546. PubMed
  7. Domingos PL, et al. 2012. An. Bras. Dermatol. 87:851. (IHC)
RRID
AB_2783245 (BioLegend Cat. No. 350033)

Antigen Details

Structure
50 kD, TNF receptor family
Distribution

Activated T cells

Function
Receptor for OX40 ligand, co-stimulatory signal for T cell proliferation and survival.
Ligand Receptor
OX40L (CD252)
Cell Type
T cells, Tregs
Biology Area
Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Immunology
Molecular Family
CD Molecules, Immune Checkpoint Receptors
Antigen References

1. Smith CA, et al. 1994. Cell. 76:959.
2. Chen AL, et al. 1999. Immunity. 11:689.
3. Croft M. 2010. Annu. Rev. Immunol. 28:57.
4. Ruby CE, et al. 2009. J. Immunol. 183:5079.
5. Klinger M, et al. 2009. J. Immunol. 182:4581.

Gene ID
7293 View all products for this Gene ID
UniProt
View information about CD134 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 10/12/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account