TotalSeq™-A0129 anti-human CD140b (PDGFRβ) Antibody

Pricing & Availability
Clone
18A2 (See other available formats)
Other Names
Platelet-derived growth factor receptor, beta polypeptide, PDGFR1, PDGFRβ, PDGFRb, PDGF receptor beta
Isotype
Mouse IgG1, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
323609 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD140b is a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. The identity of the growth factor bound to the receptor determines whether the functional receptor is a homodimer or heterodimer composed of both PDGFR-α and -β. CD140b contains two immunoglobulin-like domains and a tyrosine kinase domain with a predicted molecular weight approximately 124 kD. CD140b is widely expressed on a variety of mesenchymal-derived cells and is preferentially expressed on some tumors such as medulloblastoma. Binding of B-chain containing PDGF molecules can stimulate cell proliferation. CD140b has been shown to interact with a number of kinases (including Raf-1, NCK1, FAK, Fyn, others) as well as adaptor molecules and signaling intermediates (Crk, Grb2, Grb4, RasGAP, SHP2, SHC1, others), and has also been shown to associate with integrin β3 and nexin sorting molecules. CD140b has been implicated in several disease states including atherogenesis and oncogenesis. The PDGFRβ is heavily phosphorylated on numerous tyrosine residues through both autophosphorylation and ligand-dependent processes. 

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Human, African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
NIH-3T3 cells transfected with human PDGFRbeta
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The 18A2 monclonal antibody recognizes human CD140b also known as the platelet-derived growth factor receptor, beta polypeptide, PDGFR1, and PDGFRβ. It has been shown to be useful for flow cytometric detection of CD140b.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The TotalSeq™-A barcode sequence associated with clone 18A2 is CAATGGTTCACTGCC.

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the capture sequence, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [CAATGGTTCACTGCC]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Vogel W, et al. 2002. Haematologica 88:126.
  2. Arima, S., et al 2011. Development. 138:4763. PubMed.
RRID
AB_2783192 (BioLegend Cat. No. 323609)

Antigen Details

Structure
Cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. The identity of the growth factor bound to the receptor determines whether the functional receptor is a homodimer or heterodimer composed of both PDGFR1 and PD
Distribution

Widely expressed on a variety of mesenchymal-derived cells. Preferentially expressed in medulloblastoma.

Function
Stimulation of cell proliferation; mitogenic activity for cells of mesenchymal origin. Has been implicated in atherogenesis and oncogenesis.
Interaction
Interacts with a number of kinases (including Raf-1, NCK1, FAK, Fyn, others) as well as adaptor molecules and signaling intermediates (Grb2, Grb4, RasGAP, SHP2, SHC1, Crk, others). Has also been shown to associate with integrin β3 and nexin sorting m
Ligand Receptor
Binds to B-chain containing PDGF molecules as well as protease-activated PDGF-C
Modification
Multiple tyrosine phosphorylation sites (Y549, Y581, Y716, Y740, Y751, Y763, Y771, Y775, Y857, Y1009, Y1021)
Cell Type
Embryonic Stem Cells, Mesenchymal cells, Mesenchymal Stem Cells
Biology Area
Angiogenesis, Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers, Stem Cells
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References

1. Claesson-Welsh L, et al. 1988. Mol. Cell Biol. 8:3476.
2. Gronwald RG, et al. 1988. Proc. Natl. Acad. Sci. USA 85:3435.
3. Gilbertson DG, et al. 2001. J. Biol. Chem.276:27406.
4. Seifert RA, et al. 1989. J. Biol. Chem. 264:8771.
5. Kanakaraj P, et al. 1991. Biochemistry 30:1761.

Gene ID
5159 View all products for this Gene ID
UniProt
View information about CD140b on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 12/05/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account