TotalSeq™-A0116 anti-mouse Ly-6G/Ly-6C (Gr-1) Antibody

Pricing & Availability
Clone
RB6-8C5 (See other available formats)
Other Names
Gr-1
Isotype
Rat IgG2b, κ
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
108459 10 µg £218
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Gr-1 is a 21-25 kD protein also known as Ly-6G/Ly-6C. This myeloid differentiation antigen is a glycosylphosphatidylinositol (GPI)-linked protein expressed on granulocytes and macrophages. In bone marrow, the expression levels of Gr-1 directly correlate with granulocyte differentiation and maturation; Gr-1 is also transiently expressed on bone marrow cells in the monocyte lineage. Immature Myeloid Gr-1+ cells play a role in the development of antitumor immunity.

Product Details
Technical Data Sheet (pdf)

Product Details

Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Raised against granulocytes of mouse origin
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA.
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions. The solution is free of unconjugated DNA and unconjugated antibody.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. For Proteogenomics TotalSeq™-A analysis, the suggested use of this reagent is ≤ 1.0 µg per million cells in 100 µl volume. It is recommended that the reagent be titrated for optimal performance for each application.

To maximize performance, centrifuge the antibody dilution (1.0 µg of antibody in 100 µl of staining buffer for every 1 million cells) before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone RB6-8C5 binds with high affinity to mouse Ly-6G molecules and to a lower extent to Ly-6C19. Clone RB6-8C5 impairs the binding of anti-mouse Ly-6G clone 1A819. However, clone RB6-8C5 is able to stain in the presence of anti-mouse Ly-6C clone HK1.420.

The RB6-8C5 antibody has been used to identify peripheral blood neutrophils and deplete granulocytes in vivo. Additional reported applications (for relevant formats of this clone) include: in vitro complement-mediated cytotoxicity2, in vivo depletion3-5,9, immunoprecipitation1, immunohistochemical staining6 (including paraffin-embedded sections9,16, acetone-fixed frozen sections11 and zinc-fixed sections15), and Western blotting7. RB6-8C5 is not suitable for depletion of hepatic myeloid derived suppressor cells (MDSCs)20.

Special Note: The LEAF™ purified antibody (Endotoxin <0.1 EU/μg, Azide-Free, 0.2 μm filtered) is recommended for functional assays (Cat. No. 108414). For in vivo studies or highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 108436) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin <0.01 EU/µg).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein expression at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The TotalSeq™-A barcode sequence associated with clone RB6-8C5 is TAGTGTATGGACACG.

The flanking sequences are CCTTGGCACCCGAGAATTCCA, and the capture sequence, BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A, B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

The full oligomer sequence for this product, with the specific barcode in brackets is CCTTGGCACCCGAGAATTCCA [TAGTGTATGGACACG]BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.

Application References

(PubMed link indicates BioLegend citation)
  1. Fleming TJ, et al. 1993. J. Immunol. 151:2399. (IP)
  2. Brummer E, et al. 1984. J. Leukocyte Biol. 36:505. (CMCD)
  3. Stoppacciaro A, et al. 1993. J. Exp. Med. 178:151. (Deplete)
  4. Tumpey TM, et al. 1996. J. Virol. 70:898. (Deplete)
  5. Czuprynski CJ, et al. 1994. J. Immunol. 152:1836. (Deplete)
  6. Nitta H, et al. 1997. Cell Vision 4:73. (IHC)
  7. Jutila MA, et al. 1988. Eur. J. Immunol. 18:1819. (WB)
  8. Engwerda CR, et al. 2004. Am. J. Pathol. 165:2123.
  9. Brown CR, et al. 2004. Infect. Immun. 72:4956. (Deplete, IHC)
  10. Andoniou CE, et al. 2005. Nature Immunology 6:1011. (FC) PubMed
  11. Li M, et al. 2006. P. Natl. Acad. Sci USA 103:11736. (IHC)
  12. Dzhagalov I, et al. 2007. Blood 109:1620. (FC) PubMed
  13. Fazilleau N, et al. 2007. Nature Immunol. 8:753. (FC) PubMed
  14. Heuser M, et al. 2007. Blood 110:1639. (FC) PubMed
  15. Wang T, et al. 2007. Infect. Immun. 75:1144. (IHC)
  16. Bosio CM, et al. 2007. J. Immunol. 178:4538. (IHC)
  17. Boehme SA, et al. 2009. Int. Immunol. 21:81. (IHC)
  18. Piao Y, et al. 2012. Neuro Oncol. 14:1379. PubMed
  19. Ribechini E, et al. 2009. Eur. J. Immunol. 39:3538.
  20. Ma C, et al. 2012. J. Leukoc. Biol. 92:1199.
  21. Li J, et al. 2012. Arthritis Rheum. 64:1098. PubMed
  22. Fan Q, et al. 2014. Cancer Res. 74:471. PubMed
  23. Korrer MJ, et al. 2014. PLoS One. 9:91370. PubMed
  24. Morshed M, et al. 2014. J Immunol. 192:5314. PubMed
  25. Collins C, et al. 2014. PNAS. 111:9899. PubMed
  26. Madireddi S, et al. 2014. J Exp Med. 211:1433. PubMed
  27. Bianchi G, et al. 2014. Cell Death Dis. 5:1135. PubMed
  28. Guo H, et al. 2014. J Leukoc Biol. 96:419. PubMed
  29. Roderick JE, et al. 2014. PNAS. 111:14436. PubMed
  30. Distel E, et al. 2014. Circ Res. 115:759. PubMed
  31. Iwai H, et al. 2015. Tuberculosis. 95:246. PubMed
  32. Charmsaz S, et al. 2015. PLoS One. 10:130692. PubMed
RRID
AB_2783050 (BioLegend Cat. No. 108459)

Antigen Details

Structure
21-25 kD
Distribution

Granulocytes, monocytes

Cell Type
Granulocytes, Monocytes, Neutrophils
Biology Area
Immunology, Innate Immunity
Antigen References

1. Fleming TJ, et al. 1993. J. Immunol. 151:2399.
2. Jutila MA, et al. 1988. Eur. J. Immunol. 18:1819.
3. Goni O, et al. 2002. Int. Immunol. 14:1125.

Gene ID
17067 View all products for this Gene ID 546644 View all products for this Gene ID
UniProt
View information about Ly-6G/Ly-6C on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 08/30/2018

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 9727 Pacific Heights Blvd, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login / Register
Forgot your password? Reset password?
Create an Account