TotalSeq™-D0391 anti-human CD45 Antibody

Pricing & Availability
Clone
HI30 (See other available formats)
Regulatory Status
RUO
Workshop
IV N816
Other Names
LCA, T200
Isotype
Mouse IgG1, κ
Barcode Sequence
TGCAATTACCCGGAT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
304089 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD45 is a 180-240 kD single chain type I membrane glycoprotein also known as leukocyte common antigen (LCA) and T200. It is a tyrosine phosphatase expressed on the plasma membrane of all hematopoietic cells, except erythrocytes and platelets. CD45 is a signaling molecule that regulates a variety of cellular processes including cell growth, differentiation, cell cycle, and oncogenic transformation. CD45 plays a critical role in T and B cell antigen receptor-mediated activation by dephosphorylating substrates including p56Lck, p59Fyn, and other Src family kinases. CD45 non-covalently associates with lymphocyte phosphatase-associated phosphoprotein (LPAP) on T and B lymphocytes. CD45 has been reported to bind galectin-1 and to be associated with several other cell surface antigens including CD1, CD2, CD3, and CD4.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human
Reported Reactivity
Chimpanzee
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections and formalin-fixed paraffin-embedded tissue sections9, inhibition of CD45 functions4, immunofluorescence11, Western blotting3, and spatial biology (IBEX)16,17.

It was found that the HI30 clone and the 2D1 clone can cross block each other's binding.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press. New York.
  2. Kishihara K, et al. 1993. Cell 74:143.
  3. Esser M, et al. 2001. J. Virol. 75:6173. (WB)
  4. Yamada T, et al. 2002. J. Biol. Chem. 277:28830.
  5. Nagano M, et al. 2007. Blood 110:151.
  6. Jiang Q, et al. 2008. Blood 112:2858. PubMed
  7. Morozov A, et al. 2010. Clin Cancer Res. 16:5630. PubMed
  8. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  9. Friedman T, et al. 1999. J. Immunol. 162:5256. (IHC)
  10. Oeztuerk-Winder F, et al. 2012. EMBO J. 31:3431. (FC) PubMed
  11. Rees LE, et al. 2003. Clin. Exp. Immunol. 134:497. (IF)
  12. Lee J, et al. 2015. J Exp Med. 212:385. PubMed
  13. Breton G, et al. 2015. J Exp Med. 212:401. PubMed
  14. Marquardt N, et al. 2015. J Immunol. 6:2467. PubMed
  15. Bushway ME, et al. 2014. Biol Reprod. 90(5): 110. (IF) PubMed
  16. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  17. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID
AB_2941470 (BioLegend Cat. No. 304089)

Antigen Details

Structure
Tyrosine phosphatases, type I transmembrane protein, 180-240 kD (multiple isoforms)
Distribution

Hematopoietic cells, not expressed in circulating erythrocytes or platelets

Function
TCR and BCR mediated activation
Ligand/Receptor
Galectin-1, CD2, CD3, CD4
Cell Type
Hematopoietic stem and progenitors, Mesenchymal Stem Cells
Biology Area
Cell Biology, Immunology, Inhibitory Molecules, Innate Immunity, Neuroscience, Neuroscience Cell Markers, Stem Cells
Molecular Family
CD Molecules
Antigen References
  1. Thomas M. 1989. Annu. Rev. Immunol. 7:339.
  2. Trowbridge I, et al. 1994. Annu. Rev. Immunol.12:85.
Gene ID
5788 View all products for this Gene ID
UniProt
View information about CD45 on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD45 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD45 HI30 FC
Biotin anti-human CD45 HI30 FC
FITC anti-human CD45 HI30 FC
PE anti-human CD45 HI30 FC
PE/Cyanine5 anti-human CD45 HI30 FC
Purified anti-human CD45 HI30 FC,CyTOF®,IHC-P,WB,IHC-F,ICC
APC/Cyanine7 anti-human CD45 HI30 FC
PE/Cyanine7 anti-human CD45 HI30 FC
Alexa Fluor® 488 anti-human CD45 HI30 FC
Alexa Fluor® 647 anti-human CD45 HI30 FC
Pacific Blue™ anti-human CD45 HI30 FC
Alexa Fluor® 700 anti-human CD45 HI30 FC
PerCP anti-human CD45 HI30 FC
PerCP/Cyanine5.5 anti-human CD45 HI30 FC
Brilliant Violet 421™ anti-human CD45 HI30 FC
Brilliant Violet 570™ anti-human CD45 HI30 FC
Brilliant Violet 510™ anti-human CD45 HI30 FC
Brilliant Violet 605™ anti-human CD45 HI30 FC
Brilliant Violet 650™ anti-human CD45 HI30 FC
Purified anti-human CD45 (Maxpar® Ready) HI30 FC,CyTOF®
Brilliant Violet 785™ anti-human CD45 HI30 FC
Brilliant Violet 711™ anti-human CD45 HI30 FC
PE/Dazzle™ 594 anti-human CD45 HI30 FC
Alexa Fluor® 594 anti-human CD45 HI30 IHC-P,SB
APC/Fire™ 750 anti-human CD45 HI30 FC
Pacific Blue™ anti-human CD45 HI30 FC
APC anti-human CD45 HI30 FC
PE/Cyanine7 anti-human CD45 HI30 FC
PE/Dazzle™ 594 anti-human CD45 HI30 FC
TotalSeq™-A0391 anti-human CD45 HI30 PG
TotalSeq™-B0391 anti-human CD45 HI30 PG
TotalSeq™-C0391 anti-human CD45 HI30 PG
PerCP/Cyanine5.5 anti-human CD45 HI30 FC
APC/Fire™ 750 anti-human CD45 HI30 FC
PE/Fire™ 640 anti-human CD45 HI30 FC
APC/Fire™ 810 anti-human CD45 HI30 FC
Spark YG™ 570 anti-human CD45 HI30 IHC-P
PE/Fire™ 700 anti-human CD45 HI30 FC
FITC anti-human CD45 HI30 FC
PerCP anti-human CD45 HI30 FC
Alexa Fluor® 660 anti-human CD45 Antibody HI30 FC
Spark Violet™ 538 anti-human CD45 HI30 FC
Spark YG™ 593 anti-human CD45 HI30 FC
GMP APC/Fire™ 750 anti-human CD45 HI30 FC
Spark Violet™ 538 anti-human CD45 HI30 FC
GMP APC anti-human CD45 HI30 FC
Spark UV™ 387 anti-human CD45 HI30 FC
GMP Pacific Blue™ anti-human CD45 HI30 FC
GMP PerCP anti-human CD45 HI30 FC
GMP FITC anti-human CD45 HI30 FC
PE anti-human CD45 HI30 FC
GMP PE/Dazzle™ 594 anti-human CD45 HI30 FC
GMP PerCP/Cyanine5.5 anti-human CD45 HI30 FC
Spark Blue™ 515 anti-human CD45 HI30 FC
TotalSeq™-D0391 anti-human CD45 HI30 PG
GMP PE/Cyanine7 anti-human CD45 HI30 FC
Spark Violet™ 500 anti-human CD45 HI30 FC
Go To Top Version: 1    Revision Date: 05.17.2023

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • APC anti-human CD45

  • Biotin anti-human CD45

  • FITC anti-human CD45

  • PE anti-human CD45

  • PE/Cyanine5 anti-human CD45

  • Purified anti-human CD45

  • APC/Cyanine7 anti-human CD45

  • PE/Cyanine7 anti-human CD45

  • Alexa Fluor® 488 anti-human CD45

  • Alexa Fluor® 647 anti-human CD45

  • Pacific Blue™ anti-human CD45

  • Alexa Fluor® 700 anti-human CD45

  • PerCP anti-human CD45

  • PerCP/Cyanine5.5 anti-human CD45

  • Brilliant Violet 421™ anti-human CD45

  • Brilliant Violet 570™ anti-human CD45

  • Brilliant Violet 510™ anti-human CD45

  • Brilliant Violet 605™ anti-human CD45

  • Brilliant Violet 650™ anti-human CD45

  • Purified anti-human CD45 (Maxpar® Ready)

  • Brilliant Violet 785™ anti-human CD45

  • Brilliant Violet 711™ anti-human CD45

  • PE/Dazzle™ 594 anti-human CD45

  • Alexa Fluor® 594 anti-human CD45

  • APC/Fire™ 750 anti-human CD45

  • Pacific Blue™ anti-human CD45

  • APC anti-human CD45

  • PE/Cyanine7 anti-human CD45

  • PE/Dazzle™ 594 anti-human CD45

  • TotalSeq™-A0391 anti-human CD45

  • TotalSeq™-B0391 anti-human CD45

  • TotalSeq™-C0391 anti-human CD45

  • PerCP/Cyanine5.5 anti-human CD45

  • APC/Fire™ 750 anti-human CD45

  • PE/Fire™ 640 anti-human CD45

  • APC/Fire™ 810 anti-human CD45

  • Spark YG™ 570 anti-human CD45

  • PE/Fire™ 700 anti-human CD45

  • FITC anti-human CD45

  • PerCP anti-human CD45

  • Alexa Fluor® 660 anti-human CD45 Antibody

  • Spark Violet™ 538 anti-human CD45

  • Spark YG™ 593 anti-human CD45

  • GMP APC/Fire™ 750 anti-human CD45

  • Spark Violet™ 538 anti-human CD45

  • GMP APC anti-human CD45

  • Spark UV™ 387 anti-human CD45

  • GMP Pacific Blue™ anti-human CD45

  • GMP PerCP anti-human CD45

  • GMP FITC anti-human CD45

  • PE anti-human CD45

  • GMP PE/Dazzle™ 594 anti-human CD45

  • GMP PerCP/Cyanine5.5 anti-human CD45

  • Spark Blue™ 515 anti-human CD45

  • TotalSeq™-D0391 anti-human CD45

  • GMP PE/Cyanine7 anti-human CD45

  • Spark Violet™ 500 anti-human CD45

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account