Loading...

TotalSeq™-D0224 anti-human TCR α/β Antibody

Pricing & Availability
Clone
IP26 (See other available formats)
Regulatory Status
RUO
Other Names
α/β TCR, TCR α/β
Isotype
Mouse IgG1, κ
Barcode Sequence
CGTAACGTAGAGCGA
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Quantity Check Availability Save
306751 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

The IP26 antibody reacts with a monomorphic determinant of the α/β T-cell receptor, which is expressed on greater than 95% of normal peripheral blood CD3+ T cells. The α/β TCR recognizes a peptide bound to MHC leading to T-cell activation.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: T cell activation. When co-staining with anti-CD3, we recommend using clone UCHT1, since we have confirmed that IP26 does not compete with this clone.  Other anti-CD3 clones may compete out the binding of IP26.  

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York. (FC)
  2. Joseph A, et al. 2008. J. Virol. 82:3078. (FC) PubMed
  3. Pinto JP, et al. 2010. Immunology. 130:217. PubMed
RRID
AB_2892369 (BioLegend Cat. No. 306751)

Antigen Details

Structure
Ig superfamily, with CD3 forms CD3/TCR complex
Distribution

T cells, thymocytes

Function
Antigen recognition, T cell activation
Ligand/Receptor
Peptide bound to MHC
Cell Type
T cells, Thymocytes, Tregs
Biology Area
Adaptive Immunity, Immunology
Molecular Family
TCRs
Antigen References

1. Marchalonis J, et al. 2002. J. Mol. Recognit. 15:260.

Gene ID
6955 View all products for this Gene ID 6957 View all products for this Gene ID
UniProt
View information about TCR alpha/beta on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05.24.2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Biotin anti-human TCR α/β

  • FITC anti-human TCR α/β

  • PE anti-human α/β T Cell Receptor

  • PE/Cyanine5 anti-human TCR α/β

  • Purified anti-human TCR α/β

  • PE/Cyanine7 anti-human TCR α/β

  • Alexa Fluor® 488 anti-human TCR α/β

  • Alexa Fluor® 647 anti-human TCR α/β

  • Pacific Blue™ anti-human TCR α/β

  • APC anti-human TCR α/β

  • Brilliant Violet 421™ anti-human TCR α/β

  • PerCP/Cyanine5.5 anti-human TCR α/β

  • PE/Dazzle™ 594 anti-human TCR α/β

  • APC/Cyanine7 anti-human TCR α/β

  • Alexa Fluor® 700 anti-human TCR α/β

  • Brilliant Violet 510™ anti-human TCR α/β

  • APC/Fire™ 750 anti-human TCR α/β

  • Brilliant Violet 605™ anti-human TCR α/β

  • TotalSeq™-A0224 anti-human TCR α/β

  • Brilliant Violet 711™ anti-human TCR α/β

  • Brilliant Violet 785™ anti-human TCR α/β

  • TotalSeq™-C0224 anti-human TCR α/β

  • Brilliant Violet 750™ anti-human TCR α/β

  • TotalSeq™-B0224 anti-human TCR α/β

  • PE anti-human TCR α/β

  • APC/Fire™ 810 anti-human TCR α/β

  • TotalSeq™-D0224 anti-human TCR α/β

  • GMP PE anti-human TCR α/β
ProductsHere
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account