TotalSeq™-D0088 anti-human CD279 (PD-1) Antibody

Pricing & Availability
Clone
EH12.2H7 (See other available formats)
Regulatory Status
RUO
Other Names
PD-1
Isotype
Mouse IgG1, κ
Barcode Sequence
ACAGCGCCGTATTTA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Avail. Save
329969 10 µg 260,00€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Programmed cell death 1 (PD-1), also known as CD279, is a 55 kD member of the immunoglobulin superfamily. CD279 contains the immunoreceptor tyrosine-based inhibitory motif (ITIM) in the cytoplasmic region and plays a key role in peripheral tolerance and autoimmune disease. CD279 is expressed predominantly on activated T cells, B cells, and myeloid cells. PD-L1 (B7-H1) and PD-L2 (B7-DC) are ligands of CD279 (PD-1) and are members of the B7 gene family. Evidence suggests overlapping functions for these two PD-1 ligands and their constitutive expression on some normal tissues and upregulation on activated antigen-presenting cells. Interaction of CD279 ligands results in inhibition of T cell proliferation and cytokine secretion.

Product Details
Technical data sheet

Product Details

Reactivity
Human, African Green, Baboon, Chimpanzee, Common Marmoset, Cynomolgus, Rhesus, Squirrel Monkey
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: blocking of ligand binding1-3 and immunohistochemical staining of paraformaldehyde fixed frozen sections13. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 329911 and 329912). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 329926) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin <0.01 EU/µg).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Dorfman DM, et al. 2006 Am. J. Surg. Pathol. 30:802. (FA)
  2. Radziewicz H, et al. 2007. J. Virol. 81:2545. (FA)
  3. Velu V, et al. 2007. J. Virol. 81:5819. (FA)
  4. Zahn RC, et al. 2008. J. Virol. 82:11577. PubMed
  5. Chang WS, et al. 2008. J. Immunol. 181:6707. (FC) PubMed
  6. Nakamoto N, et al. 2009. PLoS Pathog. 5:e1000313. (FA)
  7. Jones RB, et al. 2009. J. Virol. 83:8722. (FC) PubMed
  8. Vojnov L, et al. 2010. J. Virol. 84:753. (FC) PubMed
  9. Radziewicz H, et al. 2010. J. Immunol. 184:2410. (FC) PubMed
  10. Monteriro P, et al. 2011. J. Immunol. 186:4618. PubMed
  11. Conrad J, et al. 2011. J. Immunol. 186:6871. PubMed
  12. Salisch NC, et al. 2010. J. Immunol. 184:476. (Rhesus reactivity)
  13. Li H and Pauza CD. 2015. Eur. J. Immunol. 45:298. (IHC)
  14. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)

Antigen Details

Structure
Immunoglobulin superfamily
Distribution

Transiently expressed on CD4- CD8- thymocytes; upregulated in thymocytes and splenic T and B lymphocytes; expressed on activated myeloid cells

Ligand/Receptor
B7-H1 (also known as PD-L1) and B7-DC (PD-L2)
Cell Type
B cells, Lymphocytes, T cells, Thymocytes, Tregs
Biology Area
Cancer Biomarkers, Immunology, Inhibitory Molecules
Molecular Family
CD Molecules, Immune Checkpoint Receptors
Gene ID
5133 View all products for this Gene ID
UniProt
View information about CD279 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 08.12.2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.

 

*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, www.biolegend.com/ordering#license). BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.

 

BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere
Insert Note Here
Save Close Clear
Lab Timer
Tools
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account