- Clone
- TX31 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Poliovirus Receptor Related 2 Protein (PRR2), Nectin-2, Hve B
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- AACCTTCCGTCTAAG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
337427 | 10 µg | 296€ |
CD112, known as poliovirus receptor related 2 protein (PRR2), Nectin-2, or Hve B, is a type I transmembrane glycoprotein, a member of the Ig gene superfamily. It is primarily found on myelomonocytic cells, megakaryocytes, dendritic cells, mast cells, CD34 positive stem cells, endothelial cells, epithelial cells, and neuronal cells. CD112 functions as a receptor for α-herpes viruses HSV-1 and pseudorabies virus (PRV). CD112 is an adhesion molecule involved in the formation of cell junction and regulation of NK- and T cell-mediated cytotoxicity through interaction with CD226 (DNAM-1) and other nectin family molecules.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications include: partially block CD226-Fc binding to CD112 transfectant cells and partially inhibit the cytotoxicity mediated by NK and T cells.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) - RRID
-
AB_2892408 (BioLegend Cat. No. 337427)
Antigen Details
- Structure
- Type I transmembrane glycoprotein, Ig superfamily
- Distribution
-
Myelomonocytic cells, megakaryocytes, dendritic cells, mast cells, CD34-positive stem cells, endothelial cells, epithelial cells, and neuronal cells.
- Function
- Adhesion, receptor for some Herpes Viruses
- Ligand/Receptor
- CD226, CD155, Nectin-1, -3, and -4, Herpes Viruses
- Cell Type
- Dendritic cells, Endothelial cells, Epithelial cells, Hematopoietic stem and progenitors, Mast cells, Megakaryocytes
- Biology Area
- Cell Biology, Immunology, Innate Immunity, Neuroscience, Synaptic Biology
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Zola H et al. Eds. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers. Wiely-Liss A John Wiley & Sons Inc, Publication
2. Bachelet I, et al. 2006. J. Bio. Chem. 281:27190
3. Pende D, et al. 2006. Blood 107:2030
4. Bottino C, et al. 2003. J. Exp. Med. 198:557 - Gene ID
- 5819 View all products for this Gene ID
- UniProt
- View information about CD112 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD112 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
APC anti-human CD112 (Nectin-2) | TX31 | FC |
PE anti-human CD112 (Nectin-2) | TX31 | FC |
Purified anti-human CD112 (Nectin-2) | TX31 | FC |
PerCP/Cyanine5.5 anti-human CD112 (Nectin-2) | TX31 | FC |
PE/Cyanine7 anti-human CD112 (Nectin-2) | TX31 | FC |
TotalSeq™-A0024 anti-human CD112 (Nectin-2) | TX31 | PG |
TotalSeq™-C0024 anti-human CD112 (Nectin-2) | TX31 | PG |
Ultra-LEAF™ Purified anti-human CD112 (Nectin-2) | TX31 | FC,Block |
TotalSeq™-B0024 anti-human CD112 (Nectin-2) Antibody | TX31 | PG |
TotalSeq™-D0024 anti-human CD112 (Nectin-2) | TX31 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD112 (Nectin-2)
-
PE anti-human CD112 (Nectin-2)
-
Purified anti-human CD112 (Nectin-2)
-
PerCP/Cyanine5.5 anti-human CD112 (Nectin-2)
-
PE/Cyanine7 anti-human CD112 (Nectin-2)
-
TotalSeq™-A0024 anti-human CD112 (Nectin-2)
-
TotalSeq™-C0024 anti-human CD112 (Nectin-2)
-
Ultra-LEAF™ Purified anti-human CD112 (Nectin-2)
-
TotalSeq™-B0024 anti-human CD112 (Nectin-2) Antibody
-
TotalSeq™-D0024 anti-human CD112 (Nectin-2)
Follow Us