TotalSeq™-A Antibodies and Cell Hashing with 10x Single Cell 3' Reagent Kit v3 or v3.1 (Single Index) Protocol

 

Notice: 10x Genomics has discontinued single index kits for use with Chromium Single Cell 3' v3.1 (Single Index) assays, and currently only support dual indexing with the Chromium Single Cell Gene Expression Solution. TotalSeq-A™ antibody sequencing libraries generated using BioLegend’s single index protocol are not compatible with dual index gene expression libraries. Should you have remaining 10x Genomics Gene Expression single index kits and BioLegend TotalSeq™-A single index primers for generation of sequencing libraries, you can continue to use this protocol. However, BioLegend will schedule discontinuation of this protocol by July 2023. We encourage you to adopt the dual index protocol. Please refer to the appropriate protocol for reference, named TotalSeq™-A Antibodies and Cell Hashing with 10x Single Cell 3' Reagent Kit v3.1 (Dual Index). For questions, please reach out to BioLegend Technical Services.

 

This is an updated version of our TotalSeq™-A antibodies and cell hashing with 10x Single Cell 3’ Reagent Kit v3 or v3.1 protocol. We update our protocols on a regular basis to provide improved guidance on use of our reagents and to enhance the user experience. For specific changes to this protocol, please see the change table at the bottom of the protocol. Last updated April 2021.

 

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third-party intellectual property rights to use that platform and TotalSeq™ with that platform.

The protocol below is intended for customers who are using TotalSeq™-A antibodies and cell hashing reagents with the 10x Single Cell 3’ Reagent Kit v3 or v3.1kit.

 

For customers using TotalSeq™-B  or TotalSeq™-C antibodies, please refer to our TotalSeq™-B or C protocol.

 

Please read the entire protocol below and the 10x Genomics user guide CG000185_Rev_D for v3 reagents and CG000206 Rev D for v3.1 reagents, before starting your experiments.

 

If you would like to use dual indices with TotalSeq™-A reagents please refer to our TotalSeq-A dual index protocol for guidance.

 

Commonly used abbreviations and terminology:

• ADT - Antibody Derived Tag. Refers to a TotalSeq™ DNA-barcoded oligonucleotide that is directly conjugated to a specific antibody clone of interest.  Each antibody clone was raised against a specific extracellular protein epitope and can be used to characterize the expression of that surface antigen on cells.  Thus, ADTs serve as DNA tags used to catalog and quantify distinct surface protein expression levels.
• HTO – Hash Tag Oligonucleotide. Refers to a TotalSeq™ DNA-Barcoded Oligonucleotide that is directly conjugated to a cocktail of two independent antibody clones that are specific for surface proteins known to be ubiquitously expressed on various cell types.  The intention of an HTO is to enable researchers to load multiple samples onto a single lane of a 10x chip and maintain the ability to determine sample origin.
• CITE-Seq - Cellular Indexing of the Transcriptome and Epitopes by Sequencing. This application was first described by Stoeckius et al. (Nat Methods 14, 865–868 (2017)) of the NY Genome Center as they used antibodies coupled with oligonucleotides to simultaneously measure proteins and RNA at a single-cell level.
• Cell Hashing – Application where oligo-tagged antibodies against ubiquitously expressed surface proteins uniquely label cells from distinct samples, which can be subsequently pooled. By sequencing these tags alongside the cellular transcriptome, users can assign each cell to its original sample.

 

TotalSeq™/Proteogenomics FAQ.

 

 

Reagent and Instrument List

---

 

Primers used in sequencing library construction must be ordered from 3rd party vendors prior to starting the protocol:

 

ADT additive primer (0.2µM Stock) and/or HTO additive primer v2 (0.2µM Stock) (See notes at the end of the protocol for further details on primer sequences.)

 

TruSeq Small RNA RPIx (10µM Stock) and/or TruSeq D70x_LONG (10µM Stock) primers (See notes at the end of the protocol for further details on primer sequences.)

 

10x Genomics SI-PCR primer (10µM stock) (See notes at the end of the protocol for further details on primer sequences.)

 

For a full list of sequences, view the primer sequence table below.

 

For Cell Surface staining:

• TotalSeq™-A antibodies and/or TotalSeq™-A hashtag reagents
• Biotinylated antibody and oligo-barcoded streptavidin (optional)
• Human TruStain FcX™ (Fc Receptor Blocking Solution) (BioLegend, Cat# 422301/422302)
• TruStain FcX™ PLUS (anti-mouse CD16/32) (BioLegend, Cat# 156603/156604)
• Phosphate Buffered Saline (PBS) (BioLegend, Cat# 926201 or equivalent)
• Cell Staining Buffer (BioLegend, Cat# 420201)
• 12 x 75mm Falcon™ Round-Bottom Polystyrene Tubes (Fisher Scientific, Cat# 14-959-1A or equivalent)
• Flowmi™ Cell Strainer (Bel-Art, H-B Instrument, Cat# H13680-0040)

Optional

• Curiox Laminar Washing
  Some users may be using the Curiox Laminar Wash system, which has equivalent performance to centrifugation-based washing.
• Corning™ ThermalTray™ Thermo-conductive Platforms (Product Number 432074)

 

For library preparation:

• Quantabio sparQ HiFi PCR Master Mix (2X) (Quantabio, Cat# 95192-250) or KAPA HiFi HotStart ReadyMix (2X) (Kapa Biosystems, Cat# KK2601)
• Quantabio sparQ PureMag Beads (Quantabio, Cat# 951960) or SPRIselect reagent (Beckman Coulter, Cat# B23317)
• 4200 Tapesation (Agilent Technologies, Cat# G2991A)
• DNA High Sensitivity D1000 and High Sensitivity D5000 (Agilent, Cat# 5067-5584/5067-5592)
• Qubit™ 3 (Thermo Fisher Scientific, Cat# Q33226)
• Qubit™ dsDNA HS Assay Kit (Thermo Fisher, Cat# Q32854/Q32851)
• ADT additive primer (0.2µM Stock) and/or HTO additive primer v2 (0.2µM Stock) (See notes at the end of the protocol for further details on primer sequences.)
• TruSeq Small RNA RPIx (10µM Stock) and/or TruSeq D70x_s (10µM Stock) primers (See notes at the end of the protocol for further details on primer sequences.)

 

Other essential reagents:

• Nuclease-free Water (Thermo Fisher, Cat# AM9937)
• Ethanol (Sigma, Cat# E7023-500ML)
• Nuclease-Free Pipette Tips (e.g. Thermo Fisher Scientific AM12650, AM12660 or equivalent)
• TempAssure PCR 8-strips (USA Scientific, Cat# 1402-4700)
• PCR Thermocycler (Bio-Rad, T100™ Thermal Cycler)
• Countess™ II FL Automated Cell Counter (ThermoFisher, Cat# AMQAF1000)

 

Researchers are advised to validate equivalent products when substituting for the above recommendations.

 

Protocol

---

I) Cell labeling

 

1. Prepare cell suspensions.

    

   • This protocol has been optimized using fresh human PBMCs isolated using Ficoll gradients and mouse splenocytes prepared using mechanical dissociation. If using cells isolated from whole lysed blood or other sample types, users may need to optimize staining concentrations.
   • BioLegend has not tested this protocol using single cell suspensions derived from enzymatically digested tissue. Enzymatic digestion may result in cleavage of epitopes and result in reduced staining with TotalSeq™ antibodies. Optimization of staining conditions and concentrations may be required.
2. Assess Cell Viability. Carefully count all cells to ensure accurate quantitation and assess cell viability.  Ideal cell viability is ≥ 95%.

    

   • Low cell viability is associated with generation of poor data and is not ideal for single cell experimentation. If low cell viability is observed, users may need to enrich live cells or repeat cell suspension preparation.
   • Contact Technical Services with any questions regarding cell viability. BioLegend uses a Countess II for counting and assessing cell viability, however other methods for assessing cell viability are suitable. For more information about the protocol used by BioLegend, see the following link, details can be found under “PBMC viability assessment—general methods”.
3. Dilute cells in appropriate volume prior to staining.

    

   • If working with human cells, dilute 1 million cells in 45 μL of Cell Staining Buffer in 12 x 75mm flow cytometry tubes.
   • If working with mouse cells, dilute 1 million cells in 49.5 μL of Cell Staining Buffer in 12 x 75mm flow cytometry tubes.
4. Block cells.

    

   • Add 5 µL of Human TruStain FcX™ Fc Blocking reagent or 0.5 µL of TruStain FcX™ PLUS (anti-mouse CD16/32) antibody. The final blocking volume should be 50 µL.
   • Incubate for 10 min at 4°C.
   • While cells are incubating in Fc Block, proceed to step 5.
5. Prepare antibody pool using titrated amounts (up to 1 µg) of each TotalSeq™, Cell Hashing, and/or biotinylated antibody. For more information regarding TotalSeq™ antibody concentrations, please reach out to BioLegend Tech Services.

    

   • When performing dual staining with cell hashing antibodies and TotalSeq™ antibodies, we recommend adding cell hashing antibodies into each respective sample’s TotalSeq™ antibody pool. If sequentially staining samples, stain with cell hashing antibodies first and then pool your hashtag labeled samples for TotalSeq™ antibody staining. Please note that in some cases cell recovery may be diminished.   
   • If using biotinylated antibodies, we recommend staining with your primary antibody first followed by staining with streptavidin TotalSeq™ conjugates. Do not stain with more than 1 unique biotinylated antibody for detection.
6. If antibody cocktail volume is less than 50 µL, add Cell Staining Buffer up to 50 µL, then centrifuge the antibody pool at 14,000 x g at 2 – 8°C for 10 minutes before adding to the cells. If volume of pool is above 50 µL, no volume adjustment is necessary.

    

   • If using an antibody cocktail larger than 50 µL, contact Tech Services or your local Technical Applications Scientist for protocol guidance before proceeding with this protocol.
7. Carefully pipette out the prepared antibody pool, avoiding the bottom of the tube, and add the TotalSeq™ antibody cocktail to the 50 µL blocked cell suspension.

    

   • Note for Curiox Laminar Wash system users: Transfer 80μL* of cell suspension to one well of the Curiox Wash plate and place on the Thermal Tray** on ice.

      

          i) *80μL is the maximum volume of cells that can be used with Curiox Laminar Wash system.

      

          ii) **Either ThermalTray or traditional incubation methods can be used.
8. Incubate for 30 minutes at 4°C.

    

   • Note for Curiox Laminar Wash system users: Perform the following after step 8, transfer Curiox Wash Plate to the Curiox Laminar Wash System and wash using the following parameters (Flow Rate: 10, # of cycles: 25). Remove Curiox Wash Plate from the system and add 40μL of wash buffer to the well containing the washed cells. Resuspend by pipetting gently.
   • Proceed to step 11.
9. Add 3 mL of Cell Staining Buffer and spin at 4°C for 5 minutes at 400 x g -600 x g depending on your sample type. Repeat wash 2 more times for a total of 3 washes.

    

   • BioLegend recommends the use of a swing bucket centrifuge as centrifuging with fixed angle rotors may lead to “smearing” of the cell pellet, which may result in cell loss. Contact technical service or local field representative if you have any questions.
   • BioLegend recommends manually pouring out the supernatant, being careful not to disrupt the cell pellet. Between 50- 150 μL of residual supernatant will remain in the tube after decanting, which is taken into consideration in step 11 of this protocol. Do not try to forcefully remove any remaining liquid as this will disrupt the cell pellet and result in cell loss.
10. If using a biotinylated primary antibody, incubate the stained cells with the appropriate oligo barcoded streptavidin at the recommended amount specified on the product technical datasheet for 20 minutes. Repeat step 9, then proceed to step 11.
11. Add 200 μL of Cell Staining Buffer to the cells for an approximate final volume of 250-350 µL.
12. Slowly filter cells through 40 µm Flowmi™ Cell Strainer.

     

    • Note: 40 µm Flowmi™ Cell Strainer may be too small for some sample types.
13. Verify cell concentration and viability after filtration.

     

    • Note: If using the 10x Genomics Chromium Controller for single cell partitioning, we highly recommend determining cell viability. Ideally the viability should be >90% after filtration for optimal capture rate. The presence of a large number of non-viable cells can decrease the efficiency of cell partitioning and recovery within the 10x Genomics Chromium chip.
14. Adjust cell concentration using PBS according to the input requirements of your single cell partitioning platform.

 

II) Run 10x Genomics single cell 3' v3 or v3.1 assay as described through Post Gem-RT Cleanup – Dynabeads (step 2.1). 10x Genomics Documents CG000185_Rev_D for v3 assay or CG000206_Rev_D for v3.1.

At cDNA amplification step (Step 2.2), use the following table to prepare cDNA amplification mix:

 

	ADT 1 rxn (µl)	HTO 1rxn (µl)	ADT + HTO 1 rxn (µl)
Amp Mix	50	50	50
cDNA Primers*	15	15	15
ADT Additive Primer (0.2 µM stock)	1	0	1
HTO Additive primer v2 (0.2 uM stock)	0	1	1
Total	66	66	67

* included with 10x Genomics 3’ kit, different from Feature cDNA primers 2.

 

1. Add amplification mix to 35 µL of the sample.
2. Mix by pipetting 15x with the pipette set to 90 µL. Centrifuge briefly.
3. Proceed to the 10x User Guide  CG000185_Rev_D for v3 reagents or CG000206 Rev D for v3.1 reagents and follow step 2.2d (thermal cycler protocol) of the cDNA Amplification.

Important:  Follow steps 2.3A and 2.3B exactly to separate ADTs/HTOs from cDNA. Continue to use 70 µL of sparQ or SPRI beads in step 2.3B.

 

III) ADT and mRNA library preparation

Important: For samples that contain both ADTs and HTOs, you will need to perform two separate reactions when preparing the libraries, one for the ADT library and one for the HTO library. Use 5 µL of the “purified ADT/HTO fraction” from step 2.3B of the 10x Genomics protocol for each reaction and proceed with preparing the reaction mix using the table below.

• A) At Cell Surface Protein Library Construction (Step 4.1) in the 10x user guide CG000185_Rev_D for v3 reagents or CG000206 Rev D for v3.1 reagents, use the following table to prepare the Sample Index PCR Mix.

For ADT	For HTO	Volume (µl)
Purified ADT/HTO fraction	Purified ADT/HTO fraction	5
SI PCR primer (10uM stock)	SI PCR primer (10uM stock)	2.5
TrueSeq Small RNA RPIx (10uM stock)	TruSeq D70x_LONG primer (10µM stock)	2.5
2X QuantaBio or Kapa Hifi Master Mix	2X QuantaBio or Kapa Hifi Master Mix	50
RNAse-free water	RNAse-free Water	40
	Total	100

 

•  
• B) Incubate in a thermal cycler with the following protocol:

 

ADT 98°C 2min   98°C 20sec 14 - 15 Cycles 60°C 30sec 72°C 20sec 72°C 5min   4°C hold

HTO 98°C 2min   98°C 20sec 13 - 15 Cycles 64°C 30sec 72°C 20sec 72°C 5min   4°C hold

 

•  
• C) Post ADT/HTO library amplification clean-up

1. Add 120 µl sparQ or SPRIselect Reagent (1.2X) to each sample.
2. Incubate 5 min at room temperature.
3. Place on the magnet in its High position until the solution clears.
4. Carefully remove and discard the supernatant.
5. Place tubes on magnet in its High position. Wash pellet twice with 200 µl 80% ethanol.
6. Centrifuge briefly. Place on the magnet Low. Remove remaining ethanol.
7. Remove from the magnet. Add 40.5 µl water.
8. Incubate 2 min at room temperature.
9. Place on the magnet in its Low position until the solution clears.
10. Transfer 40 µl to a new tube strip. Store at 4°C for up to 72 h or at −20°C for long-term storage.
11. ADT/HTO libraries are now ready to be sequenced
    Quantify libraries by standard methods (QuBit, BioAnalyzer, qPCR).     
    ADT libraries will be around 180 bp (Figure 1B).

Sequencing CITE-seq libraries:

To obtain sufficient read coverage for both libraries, we typically sequence ADT libraries in 5-10% of a lane and cDNA library fraction at 90% of a lane (HiSeq2500 Rapid Run Mode Flow Cell). See table below for sequencing depth recommendations

 

Library Type	Minimum Sequencing Depth (reads/cell)
3' Gene Expression Library	20,000-50,000
Cell Surface Protein Library <100 ADT panel	5,000
Cell Surface Protein Library ≥100 ADT panel	10,000
Cell Hashing Libraries	500

 

TotalSeq A – Single Index Read Length Requirements

 

Scenario 1. Sequencing antibody and RNA libraries together

 

	Read1	Index1 (i7)	Index2 (i5)	Read2
Number of cycles	28	8	0	91

 

Scenario 2. Sequencing HTO only, or HTO+ADT

 

	Read1	Index1 (i7)	Index2 (i5)	Read2
Number of cycles	28	8	0	25

 

Scenario 3. Sequencing ADT only

 

	Read1	Index1 (i7)	Index2 (i5)	Read2
Number of cycles	28	6	0	25

 

Notes:

Oligonucleotide sequences:

TotalSeq™ antibodies. Each clone is barcoded with a unique oligonucleotide sequence. These contain standard small TruSeq RNA read 2 sequences and can be amplified using Illumina’s Truseq Small RNA primer sets (RPIx – primers, see example RPI1 below)

CCTTGGCACCCGAGAATTCCAAACAAGACCCTTGAGBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A.


Please visit https://www.biolegend.com/totalseq for detailed information:

Oligos required for ADT library amplification:

• PAGE purification is the preferred method when ordering primers.
• The phosphorothioate bonds in the primer renders the oligonucleotide resistant to nuclease degradation.
• A unique Illumina primer (index) should be used for each 10x Genomics sample lane used within one sequencing lane.

 

1. 10x Genomics SI-PCR primer 5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC*T*C
2. ADT cDNA PCR additive primer 5’CCTTGGCACCCGAGAATT*C*C
3. HTO cDNA PCR additive primer v2 5’GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T
4. Illumina Small RNA RPI1 primer (for ADT amplification; i7 index 1, Oligonucleotide sequences, Illumina) 5’CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A
5. Illumina TruSeq D701_LONG primer (for HTO amplification; i7 index 1) 5’CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T

* indicates a phosphorothioate bond
B indicates C or G or T; not A nucleotide

 

Primers Used for Sequencing Library Construction:

 

Name	Sequence 5’ -> 3’	Do Not Use with 10x Index
SI-PCR primer	AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC*T*C
HTO additive primer v2	GTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T
ADT additive primer	CCTTGGCACCCGAGAATT*C*C
D701_LONG	CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T
D702_LONG	CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T
D703_LONG	CAAGCAGAAGACGGCATACGAGATAATGAGCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T
D704_LONG	CAAGCAGAAGACGGCATACGAGATGGAATCTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T
D705_LONG	CAAGCAGAAGACGGCATACGAGATTTCTGAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T
D706_LONG	CAAGCAGAAGACGGCATACGAGATACGAATTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T
D707_LONG	CAAGCAGAAGACGGCATACGAGATAGCTTCAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T
D708_LONG	CAAGCAGAAGACGGCATACGAGATGCGCATTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T
D709_LONG	CAAGCAGAAGACGGCATACGAGATCATAGCCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T
D710_LONG	CAAGCAGAAGACGGCATACGAGATTTCGCGGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T
D711_LONG	CAAGCAGAAGACGGCATACGAGATGCGCGAGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T	SI-GA-E7
D712_LONG	CAAGCAGAAGACGGCATACGAGATCTATCGCTGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT*C*T	SI-GA-A10
RPI1	CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A
RPI2	CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A
RPI3	CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A
RPI4	CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A
RPI5	CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A
RPI6	CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A
RPI7	CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A	SI-GA-A11
RPI8	CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCCTTGGCACCCGAGAATTC*C*A

 

Representative Data and Troubleshooting

 

A.

B.

Figure 1. ADT library verification.
(Left graph) A TSO-RT-oligo product (~140 bp) can be amplified during the ADT PCR by carryover primers from cDNA amplification. The product will not cluster but will interfere with quantification. Sequential 2X sparQ or SPRI purification of the ADT fraction after cDNA amplification reduces carryover of primers from cDNA amplification, and minimizes the amplification of this product during ADT-library amplification. To further enrich for ADT specific product the purified ADT library can be reamplified for 3 additional cycles with ADT specific primer sets or P5/P7 generic primers. (Right graph) A clean ADT library will contain a predominant single peak at around 180 bp.


 

Figure 2. My ADT/HTO library contains a large peak at ~400bp
Overamplification of a library can lead to depletion of available primers and/or dNTPs resulting in self-priming of PCR products by their P5 and/or P7 adapters. This can lead to the production of “daisy-chains” or “bubble products”. These products consist of essentially 2 ADT or HTO barcode sequences attached to one another in 1 long oligo tag that is twice as long as the original oligo tag; these products appear as peaks at approximately 400 bp. These peaks can be more or less pronounced (panel A and B respectively).  

The larger peak is perfectly acceptable to sequence. However, it is difficult to quantify these libraries to titrate for sequencing. This error can be corrected by performing another PCR reaction using generic P5/P7 primers (not used in the protocol) for one or two cycles on the 1.2x sparQ or SPRI cleaned up product. The PCR reaction will convert the larger product to the desired size product partially (panel C) or completely (panel D) as the major peak.

 

---

 

Version Change Table

 

Date	Section	Changes
04/2021	Reagents and Instrument List	Added 10x Genomics SI-Primer to list of primers that must be ordered from 3rd party vendors
04/2021	Section 5	Updated guidance on TotalSeq™ antibody preparation
04/2021	Introduction and Section 2	Updated links to 10x Genomics User Manual
12/2020	Section 1 step 1	Added general information regarding types of cells and cell isolation methods used during testing. Also, added information regarding cells isolated via enzymatic digestion of whole tissues.
12/2020	Section 1 step 2	Added information regarding methods used to assess cell viability
12/2020	Section 1 step 5	Added “Contact Technical Services” regarding antibody staining concentrations.
12/2020	Section 1 step 8	Added protocol information for the use of the Curiox Laminar Washing System
12/2020	Section 1 step 9	Reduced wash volumes from 3.5mL to 3mL
12/2020	Section 1 step 9	Changed centrifugation speed recommendation from 400 x g to 400 x g -600 x g
12/2020	Section 1 step 11	Changed resuspension volume from 500 µL to 250-350 µL
12/2020	Section 3 PCR conditions	Changed conditions from 12-13 cycles to 13-15 cycles when amplifying HTO libraries
12/2020	Section 3 Sequencing depth recommendations	Added recommended sequencing depths
12/2020	Primer sequences table	Provided longer D70X primer sequences to help reduce the occurrence of HTO drop outs.