TotalSeq™-D0205 anti-human CD206 (MMR) Antibody

Pricing & Availability
15-2 (See other available formats)
Regulatory Status
Other Names
MMR (macrophage mannose receptor), MR (mannose receptor), CD206, MRC1
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
321155 10 µg 287€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

Macrophage mannose receptor (MMR) is a 162-175 kD type I membrane protein also known as CD206, MRC1, or mannose receptor (MR). It is a pattern recognition receptor (PRR) that belongs to C-type lectin superfamily. MMR is expressed on macrophages, dendritic cells, and hepatic or lymphatic endothelial cells, but not on monocytes. MMR recognizes a range of microbial carbohydrates bearing mannose, fucose, or N-acetyl glucosamine. MMR mediates endocytosis and phagocytosis, induces activation of macrophages and antigen presentation, plays an important role in host defense, and provides a link between innate and adaptive immunity.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Antibody Type
Host Species
Purified human mannose receptor
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The 15-2 antibody blocks the interaction of MMR with its ligand, and inhibits mannose receptor-mediated degradation of t-PA by macrophages. Additional reported applications of this antibody (for the relevant formats) include: Western blotting1, blocking of ligand binding1,2, immunofluorescence3, and immunohistochemical staining of acetone-fixed frozen tissue sections1. The Utra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 321149 and 321150).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Noorman F, et al. 1997. J. Leukocyte Biol. 61:63. (WB, IHC, Block)
  2. Barrett-Bergshoeff M, et al. 1997. Thromb Haemost. 77:718. (Block)
  3. Kato M, et al. 2007. J. Immunol. 179:6052. (IF)
AB_2927868 (BioLegend Cat. No. 321155)

Antigen Details

Type I membrane protein, Pattern Recognition Receptor (PRR) family, C-type lectin superfamily, 162-175 kD

Macrophages, dendritic cells, hepatic and lymphatic endothelial cells

Pathogen binding, facilitate phagocytosis and endocytosis, macrophage activation and antigen presentation
Mannose, fucose, N-acetyl glucosamine
Cell Type
Dendritic cells, Endothelial cells, Macrophages
Biology Area
Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules
Antigen References

1. Mason D, et al. Eds. 2002. Leukocyte Typing VII. Oxford University Press. p303
2. Wileman TE, et al. 1986. P. Natl. Acad. Sci. USA 83:2501.
3. Apostolopoulos V and McKenzie IF. 2001. Curr. Mol. Med. 1:469.
4. Le Cabec V, et al. 2005. J. Leukocyte Biol. 77:934.
5. Barrett-Bergshoeff M, et al. 1997. Thromb. Haemostatis 77:718.

Gene ID
4360 View all products for this Gene ID
View information about CD206 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 09.20.2022

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Purified anti-human CD206 (MMR)

  • FITC anti-human CD206 (MMR)

  • PE anti-human CD206 (MMR)

  • PE/Cyanine5 anti-human CD206 (MMR)

  • APC anti-human CD206 (MMR)

  • Alexa Fluor® 488 anti-human CD206 (MMR)

  • Alexa Fluor® 647 anti-human CD206 (MMR)

  • Biotin anti-human CD206 (MMR)

  • APC/Cyanine7 anti-human CD206 (MMR)

  • PerCP/Cyanine5.5 anti-human CD206 (MMR)

  • PE/Cyanine7 anti-human CD206 (MMR)

  • Brilliant Violet 421™ anti-human CD206 (MMR)

  • Purified anti-human CD206 (MMR) (Maxpar® Ready)

  • Alexa Fluor® 700 anti-human CD206 (MMR)

  • PE/Dazzle™ 594 anti-human CD206 (MMR)

  • APC/Fire™ 750 anti-human CD206 (MMR)

  • Brilliant Violet 711™ anti-human CD206 (MMR)

  • Brilliant Violet 510™ anti-human CD206 (MMR)

  • Brilliant Violet 605™ anti-human CD206 (MMR)

  • Brilliant Violet 785™ anti-human CD206 (MMR)

  • TotalSeq™-A0205 anti-human CD206 (MMR)

  • TotalSeq™-B0205 anti-human CD206 (MMR)

  • TotalSeq™-C0205 anti-human CD206 (MMR)

  • Ultra-LEAF™ Purified anti-human CD206 (MMR)

  • Pacific Blue™ anti-human CD206 (MMR)

  • PE/Fire™ 700 anti-human CD206 (MMR)

  • TotalSeq™-D0205 anti-human CD206 (MMR)


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account