- Clone
- W6D3 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- HCDM listed
- Other Names
- Lewis X, 3-FAL, 3-FL, LNFP III, Lex , SSEA-1, X-hapten
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TCACCAGTACCTAGT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
323059 | 10 µg | 296€ |
CD15 is 3-fucosyl-N-acetyllactosamine (3-FAL) also known as Lewis X, 3-FAL, X-hapten, and SSEA-1. CD15 is expressed on granulocytes and monocytes. It has also been shown to be expressed on Langerhans cells. CD15 has been implicated in adhesion as well as chemotaxis, phagocytosis, and bactericidal activity.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- WERI-RB-1 retinoblastoma cell line
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2904344 (BioLegend Cat. No. 323059)
Antigen Details
- Structure
- Poly-N-acetyllactosamine
- Distribution
-
Neutrophils, eosinophils, monocytes
- Function
- Adhesion
- Cell Type
- Embryonic Stem Cells, Eosinophils, Neutrophils
- Biology Area
- Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers, Stem Cells
- Molecular Family
- CD Molecules
- Antigen References
-
1. Stocks SC, et al. 1990. Biochem. J. 268:275.
- Gene ID
- 2526 View all products for this Gene ID
- UniProt
- View information about CD15 on UniProt.org
Related FAQs
Other Formats
View All CD15 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Brilliant Violet 785™ anti-human CD15 (SSEA-1)
-
Purified anti-human CD15 (SSEA-1)
-
FITC anti-human CD15 (SSEA-1)
-
PE anti-human CD15 (SSEA-1)
-
APC anti-human CD15 (SSEA-1)
-
Alexa Fluor® 488 anti-human CD15 (SSEA-1)
-
Alexa Fluor® 647 anti-human CD15 (SSEA-1)
-
PE/Cyanine5 anti-human CD15 (SSEA-1)
-
PerCP anti-human CD15 (SSEA-1)
-
PerCP/Cyanine5.5 anti-human CD15 (SSEA-1)
-
Pacific Blue™ anti-human CD15 (SSEA-1)
-
Alexa Fluor® 700 anti-human CD15 (SSEA-1)
-
Brilliant Violet 510™ anti-human CD15 (SSEA-1)
-
PE/Cyanine7 anti-human CD15 (SSEA-1)
-
Brilliant Violet 605™ anti-human CD15 (SSEA-1)
-
Brilliant Violet 650™ anti-human CD15 (SSEA-1)
-
Purified anti-human CD15 (SSEA-1) (Maxpar® Ready)
-
PE/Dazzle™ 594 anti-human CD15 (SSEA-1)
-
Brilliant Violet 421™ anti-human CD15 (SSEA-1)
-
APC/Fire™ 750 anti-human CD15 (SSEA-1)
-
FITC anti-human CD15 (SSEA-1)
-
Pacific Blue™ anti-human CD15 (SSEA-1)
-
TotalSeq™-A0392 anti-human CD15 (SSEA-1)
-
Brilliant Violet 711™ anti-human CD15 (SSEA-1)
-
APC/Cyanine7 anti-human CD15 (SSEA-1)
-
TotalSeq™-B0392 anti-human CD15 (SSEA-1)
-
TotalSeq™-C0392 anti-human CD15 (SSEA-1)
-
PE anti-human CD15 (SSEA-1)
-
APC/Fire™ 810 anti-human CD15 (SSEA-1) Antibody
-
TotalSeq™-D0392 anti-human CD15 (SSEA-1)
-
GMP FITC anti-human CD15 (SSEA-1)
-
Spark YG™ 593 anti-human CD15 (SSEA-1)
-
GMP PE anti-human CD15 (SSEA-1)
-
GMP Pacific Blue™ anti-human CD15 (SSEA-1)
-
Spark Violet™ 500 anti-human CD15 (SSEA-1)
Follow Us