TotalSeq™-D0149 anti-human CD161 Antibody

Pricing & Availability
HP-3G10 (See other available formats)
Regulatory Status
Other Names
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
339953 10 µg 296€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD161 is a type II transmembrane glycoprotein, also known as NKR-P1A, that is expressed as a 40-44 kD homodimer. It is a member of the C-type lectin superfamily. CD161 is expressed on a majority of NK cells, NKT cells, and subsets of peripheral T cells and CD3+ thymocytes. It has been reported that Th17 cells are a subpopulation of CD4+CD161+CCR6+ cells. While the biological function of CD161 is not clear, it has been suggested to serve either as a stimulatory receptor or to inhibit NK cell-mediated cytotoxicity and cytokine production. LLT-1 (lectin-like transcript-1, also named as osteoclast inhibitory lectin or CLEC2D) is the ligand of CD161.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon
Antibody Type
Host Species
Human NK cells
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: inhibition of cytokine production and Western blotting under nonreducing conditions.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Gumß M, et al. 2004. Blood 104:3664.
  2. Exley M, et al. 1998. J. Exp. Med. 188:867.
  3. Marquez C, et al. 1998. Blood 91:2760.
AB_2894602 (BioLegend Cat. No. 339953)

Antigen Details

Type II glycoprotein, 40-44 kD homodimer, C-type lectin superfamily

NK cells, T subset, subset of CD3+ thymocytes

LLT-1 (Lectin-like transcript-1)
Cell Type
NK cells, T cells, Thymocytes
Biology Area
Cell Biology, Immunology, Innate Immunity, Signal Transduction
Molecular Family
CD Molecules
Antigen References

1. Takahashi T, et al. 2006. J. Immunol. 176:211.
2. Cosmi L, et al. 2008. J. Exp. Med. 205:1903.
3. Aldemir H, et al. 2005. J. Immunol. 175:7791.
4. Rosen DB, et al. 2008. J. Immunol. 180:6508.

Gene ID
3820 View all products for this Gene ID
View information about CD161 on

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 08.12.2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • Brilliant Violet 510™ anti-human CD161

  • FITC anti-human CD161

  • Purified anti-human CD161

  • PE anti-human CD161

  • PerCP/Cyanine5.5 anti-human CD161

  • Alexa Fluor® 647 anti-human CD161

  • APC anti-human CD161

  • Brilliant Violet 421™ anti-human CD161

  • Brilliant Violet 605™ anti-human CD161

  • PE/Cyanine7 anti-human CD161

  • Alexa Fluor® 700 anti-human CD161

  • Purified anti-human CD161 (Maxpar® Ready)

  • Alexa Fluor® 488 anti-human CD161

  • Pacific Blue™ anti-human CD161

  • APC/Cyanine7 anti-human CD161

  • Brilliant Violet 785™ anti-human CD161

  • Biotin anti-human CD161

  • PerCP anti-human CD161

  • PE/Dazzle™ 594 anti-human CD161

  • APC/Fire™ 750 anti-human CD161

  • TotalSeq™-A0149 anti-human CD161

  • TotalSeq™-C0149 anti-human CD161

  • TotalSeq™-B0149 anti-human CD161

  • PE/Cyanine5 anti-human CD161 Antibody

  • TotalSeq™-D0149 anti-human CD161

  • Spark Red™ 718 anti-human CD161


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account