TotalSeq™-D0083 anti-human CD16 Antibody

Pricing & Availability
3G8 (See other available formats)
Regulatory Status
V NK80
Other Names
FcγRIII, Fc gamma receptor, Fc gamma receptor 3
Mouse IgG1, κ
Barcode Sequence
Ave. Rating
Submit a Review
Product Citations
Cat # Size Price Quantity Check Availability Save
302071 10 µg 296€
Check Availability

Need larger quantities of this item?
Request Bulk Quote

CD16 is known as low affinity IgG receptor III (FcγRIII). It is expressed as two distinct forms (CD16a and CD16b). CD16a (FcγRIIIA) is a 50-65 kD polypeptide-anchored transmembrane protein. It is expressed on the surface of NK cells, activated monocytes, macrophages, and placental trophoblasts in humans. CD16b (FcγRIIIB) is a 48 kD glycosylphosphatidylinositol (GPI)-anchored protein. Its extracellular domain is over 95% homologous to that of CD16a, and it is expressed specifically on neutrophils. CD16 binds aggregated IgG or IgG-antigen complex which functions in NK cell activation, phagocytosis, and antibody-dependent cell-mediated cytotoxicity (ADCC).

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon, Capuchin Monkey, Chimpanzee, Common Marmoset, Pigtailed Macaque, Sooty Mangabey, Squirrel Monkey
Antibody Type
Host Species
Human PMN cells
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The 3G8 antibody clone blocks neutrophil phagocytosis and stimulates NK cell proliferation. It has been reported that this clone interacts with the FcγRIIa and FcγRIIIb receptors causing neutrophil activation and aggregation18. Due to this phenomenon staining in whole blood may cause a reduction in the number of granulocytes or alter their scatter profile.

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections6, immunoprecipitation3, stimulation of NK cell proliferation4, blocking of phagocytosis5, and blocking of immunoglobulin binding to FcγRIII7,8. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 302049, 302050, 302057, 302058).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Knapp W, et al. Eds. 1989. Leucocyte Typing IV. Oxford University Press. New York.
  2. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
  3. Edberg J, et al. 1997. J. Immunol. 159:3849. (IP)
  4. Hoshino S, et al. 1991. Blood 78:3232. (Stim)
  5. Tamm A, et al. 1996. Immunol. 157:1576. (Block)
  6. Da Silva DM, et al. 2001. Int. Immunol. 13:633. (IHC)
  7. Holl V, et al. 2004. J. Immunol. 173:6274. (Block)
  8. Hober D, et al. 2002. J. Gen. Virol. 83:2169. (Block)
  9. Brainard DM, et al. 2009. J. Virol. 83:7305. PubMed
  10. Smed-Sörensen A, et al. 2008. Blood 111:5037. (Block) PubMed
  11. Timmerman KL, et al. 2008. J. Leukoc. Biol. 84:1271. (FC) PubMed
  12. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  13. Rout N, et al. 2010. PLoS One 5:e9787. (FC)
  14. Kim WK, et al. 2006. Am. J. Pathol. 168:822. (FC)
  15. Boltz A, et al. 2011. J. Biol Chem. 286:21896. PubMed
  16. Wu Z, et al. 2013. J. Virol. 87:7717. PubMed
  17. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
  18. Vossebeld PJ, et al. 1997. Biochem J. 323:87-94 (Stim)
AB_2892348 (BioLegend Cat. No. 302071)

Antigen Details

Ig superfamily, transmembrane form (50-65 kD) or GPI-linked form (48 kD)

NK cells, activated monocytes, macrophages, neutrophils

Low affinity IgG Fc receptor, phagocytosis, ADCC
Aggregated IgG, IgG-antigen complex
Cell Type
Dendritic cells, Macrophages, Monocytes, Neutrophils, NK cells
Biology Area
Immunology, Innate Immunity
Molecular Family
CD Molecules, Fc Receptors
Antigen References

1. Fleit H, et al. 1982. P. Natl. Acad. Sci. USA 79:3275.
2. Stroncek D, et al. 1991. Blood 77:1572.
3. Wirthmueller U, et al. 1992. J. Exp. Med. 175:1381.

Gene ID
2214 View all products for this Gene ID
View information about CD16 on

Related FAQs

Is our human Trustain FcX™ (cat# 422302) compatible with anti human CD16, CD32 and CD64 clones 3G8, FUN-2 and 10.1 respectively?


Other Formats

View All CD16 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD16 3G8 FC
Biotin anti-human CD16 3G8 FC
FITC anti-human CD16 3G8 FC
Brilliant Violet 711™ anti-human CD16 3G8 FC
PE anti-human CD16 3G8 FC
PE/Cyanine5 anti-human CD16 3G8 FC
Purified anti-human CD16 3G8 FC, CyTOF®, Block, IHC-F, IP, Stim
APC/Cyanine7 anti-human CD16 3G8 FC
PE/Cyanine7 anti-human CD16 3G8 FC
Alexa Fluor® 488 anti-human CD16 3G8 FC
Alexa Fluor® 647 anti-human CD16 3G8 FC
Pacific Blue™ anti-human CD16 3G8 FC
Alexa Fluor® 700 anti-human CD16 3G8 FC
PerCP/Cyanine5.5 anti-human CD16 3G8 FC
PerCP anti-human CD16 3G8 FC
Brilliant Violet 421™ anti-human CD16 3G8 FC
Brilliant Violet 570™ anti-human CD16 3G8 FC
Brilliant Violet 605™ anti-human CD16 3G8 FC
Brilliant Violet 650™ anti-human CD16 3G8 FC
Brilliant Violet 785™ anti-human CD16 3G8 FC
Brilliant Violet 510™ anti-human CD16 3G8 FC
Ultra-LEAF™ Purified anti-human CD16 3G8 FC, CyTOF®, Block, IHC-F, IP, Stim
Purified anti-human CD16 (Maxpar® Ready) 3G8 FC, CyTOF®
PE/Dazzle™ 594 anti-human CD16 3G8 FC
APC/Fire™ 750 anti-human CD16 3G8 FC
PE anti-human CD16 3G8 FC
APC anti-human CD16 3G8 FC
Pacific Blue™ anti-human CD16 3G8 FC
PE/Dazzle™ 594 anti-human CD16 3G8 FC
TotalSeq™-A0083 anti-human CD16 3G8 PG
TotalSeq™-B0083 anti-human CD16 3G8 PG
TotalSeq™-C0083 anti-human CD16 3G8 PG
PE/Cyanine7 anti-human CD16 3G8 FC
PE/Fire™ 640 anti-human CD16 3G8 FC
FITC anti-human CD16 3G8 FC
Spark YG™ 581 anti-human CD16 3G8 FC
APC/Fire™ 750 anti-human CD16 3G8 FC
TotalSeq™-D0083 anti-human CD16 3G8 PG
APC/Fire™ 810 anti-human CD16 3G8 FC
GMP APC anti-human CD16 3G8 FC
GMP PE/Dazzle™ 594 anti-human CD16 3G8 FC
GMP PE anti-human CD16 3G8 FC
Spark Red™ 718 anti-human CD16 3G8 FC
GMP Pacific Blue™ anti-human CD16 3G8 FC
GMP FITC anti-human CD16 3G8 FC
Go To Top Version: 1    Revision Date: 05.24.2021

For research use only. Not for diagnostic use. Not for resale. BioLegend will not be held responsible for patent infringement or other violations that may occur with the use of our products.


*These products may be covered by one or more Limited Use Label Licenses (see the BioLegend Catalog or our website, BioLegend products may not be transferred to third parties, resold, modified for resale, or used to manufacture commercial products, reverse engineer functionally similar materials, or to provide a service to third parties without written approval of BioLegend. By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses. Unless otherwise indicated, these products are for research use only and are not intended for human or animal diagnostic, therapeutic or commercial use.


BioLegend Inc., 8999 BioLegend Way, San Diego, CA 92121
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

  • APC anti-human CD16

  • Biotin anti-human CD16

  • FITC anti-human CD16

  • Brilliant Violet 711™ anti-human CD16

  • PE anti-human CD16

  • PE/Cyanine5 anti-human CD16

  • Purified anti-human CD16

  • APC/Cyanine7 anti-human CD16

  • PE/Cyanine7 anti-human CD16

  • Alexa Fluor® 488 anti-human CD16

  • Alexa Fluor® 647 anti-human CD16

  • Pacific Blue™ anti-human CD16

  • Alexa Fluor® 700 anti-human CD16

  • PerCP/Cyanine5.5 anti-human CD16

  • PerCP anti-human CD16

  • Brilliant Violet 421™ anti-human CD16

  • Brilliant Violet 570™ anti-human CD16

  • Brilliant Violet 605™ anti-human CD16

  • Brilliant Violet 650™ anti-human CD16

  • Brilliant Violet 785™ anti-human CD16

  • Brilliant Violet 510™ anti-human CD16

  • Ultra-LEAF™ Purified anti-human CD16

  • Purified anti-human CD16 (Maxpar® Ready)

  • PE/Dazzle™ 594 anti-human CD16

  • APC/Fire™ 750 anti-human CD16

  • PE anti-human CD16

  • APC anti-human CD16

  • Pacific Blue™ anti-human CD16

  • PE/Dazzle™ 594 anti-human CD16

  • TotalSeq™-A0083 anti-human CD16

  • TotalSeq™-B0083 anti-human CD16

  • TotalSeq™-C0083 anti-human CD16

  • PE/Cyanine7 anti-human CD16

  • PE/Fire™ 640 anti-human CD16

  • FITC anti-human CD16

  • Spark YG™ 581 anti-human CD16

  • APC/Fire™ 750 anti-human CD16

  • TotalSeq™-D0083 anti-human CD16

  • APC/Fire™ 810 anti-human CD16

  • GMP APC anti-human CD16

  • GMP PE/Dazzle™ 594 anti-human CD16

  • GMP PE anti-human CD16

  • Spark Red™ 718 anti-human CD16

  • GMP Pacific Blue™ anti-human CD16

  • GMP FITC anti-human CD16


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account